Description :
From Genome Similarity Track
Location :
Scaffold_96:105002- 109818
Transcript NameFunction/comments
Phyra_83782Cyst wall protein 1
Phyra_96675Hypothetical protein

Sequence
4816 bases(100 bases per row)
TATTCGGCGTGAAGTGGGAGCGCAACCATGTCGTGGCCATCGACCTGTCCGGGAATGGACTGACGGGGGTGATCCCTGCAGAAATCACTCAACTGCGCTT
CCTGACGACGCTGAAGTTGCGCAACAATCCAAGCTTGCGTGGCTCCCTGCCGCTGGAGATGTATTCCATGCCTCATCTGAAGTATTGCTACGTGGACGGC
ACTGGGATCGAAAACGCGCTTCCTTACAACAACGCACACTCGTTCCAAATCACTCACTTTAAAACTGAATCAGTCGGAACAGCGATATCGACAGTACGGT
TTCGTACAGGTGACGAGCGTACAGGTAATATGATCCACTGGATGGCCGACATGACCGAGACCGAGATGTTTATGGTTCACTCGACACTGAAAAAGTTGCA
CGAAAACGCTGACCACGTCGCTGGTCGCCCACAGATCAAGTGTACAGCGAGCAACGCGACTGGACCGGAACGCGCCGCGGCTGCGACCAAGCTGCAGCGC
ATTTACCGAGCTCGCATCGAACGCACAAAATTCCGCAACTTTCTGCACTCGCTCGTTGAAATGAAAGTCGACTCTGCCAGCGGATACGCGTACTACGTCA
ACTCTCGAACAGGAGAAGCCACGTGGGAAAAGCCAAAGTTCCTCGGCTCGGACGGAGATAACATCCATCCCAGTGCTCACGACGTGAGGTCGAGTGACAA
CACTCAGGACCCATCGGAGGCCTGGAAGCCTTACGACGACGGCAACGGCAACACGGTAAGACGGCTTTGGCGCCTCCTTCCGTTCACCCTTGGCTGCTAA
CCAGGCGTGAAACCTTTGTGGTGCAGTACTACTGGAACAGCGCAACAGGAGAGTCAACGTGGGGGCCTCCAGCCTTCCTCAGCCGCATTTACGAAGAGCT
GCGGGAACGCTACGGCACGGACAAGACCGACGAAGAGCGGTTCGAGCTGTTTTTCCAGGATATCGATCGCGACGGCACAGGCGAAATAGACCAAGACGAG
TTTGCACGGTTGTGCGGCGACCTCGGCATGGCTTTGTCCGCCAAGCAGATCAAAGAAGTGTTTCGCGAGCTCGACACCAGCAGCGACGGTCAACTTGATC
GCCGAGAAATCATTGCGTGGCTCACGCGAAACTACAAATGAATAGAACAGCTTGAAAGCCAATGTACAATACTCAGTAACAGAGTCGCTCTATTCATCAT
CACAGAGGAGCTGCAGCAATTTCTCCGAGTCAGCGATCGTGCGCGTCAAACCAATGATTTGATTGCCACTGACCAAGTACGTGTCCGTACAGGCGCACTT
GACTGAAGGCGGCTCCGAGTCATCGAAGTCAGCGATATTTTCCGATCTGCGGAAGGTAGCGTCGAACTCCACAATCACTGAGTAGCCGATTGCCTGGATG
CTCTTCTCTTCGACGGAGACCACATCTAGGCACTGCTTAAATAATGATGCGTACTTGCTGATGCCCAGATCACCATGATAGATTCCCCAGAACGGCATTT
CCTCGGGCACCTCGGACTTGATGAAGAAGCTCGCGGAGGCCATCGGTCCCAGCAAGTTGATATCCGGAACAACCAGATAAGAACCATCCCGGTTCTTCGC
AACGCACTCGACCAGCGACGTATTAGCGGCTTCATCGATATCGCTGAAGCTGTTCCGCGACGTCCTTGTTCTCGTGACAGCGCACTGCATAGCCTCAAAC
CACCGCATCCTCGTCGCGTCTGGCCGTGTGACGAAAGTCAAGGTTTCGTCTTCCTCACGGTGGCCATCAAACACCTCAATTTGGAAGCCAAATGCACCCC
GATCCGGGTTTTTTAAGCTACGGCCGAATGCAATCCATTTTCGAGCATTGCATACAACCAGCTTCTTGGGCCGAGACGTCCAGGTTTGCTTCTGTGCCAT
CAGAAATTGCTTTAGCATGGACGCCTTGGACGGAGAAGTCGCTTTCTGTCCACCATTTCTCGGGGATCCAGAGGGTGCATCTGTGGCATCCTGCAGAGTG
AGTTGGCACGTCGCCTTCTCAAACTTTAGGTGCACCTTGATCCACTTTGAACGCTTTTGGTACGCGTACCCACTCACAAAAAAGTCGTCTTCCTCCACAT
TAAACGATGTAGATTCGTCTGACCGAAGAATATCGATAATGGATTCAGGGAATTTACTCTGTGACCGGCTCTGGAACATGTCGCTCGGGTGAACTGCTTC
ATTTCCACTAGCCAAGTTTTGTGACGATCCGAAGCCTTCTTTCTCCATCGGCAACCGTCTGAATGGCTCCAGCTCTCGTGACAGATACTCGCTAGCAGAA
GAGGACGGTCGAGCGAGTGGGAAACCGGTATCAATCTCGTCTTCGCTAGCGTTTCGCCTTCGCGGAGCTCCATTTCGCGGTCCACCTGAGATAACTTGCA
ACGCAAGCAGAGAATCATCCAGAGCGTCCATATGCTGGTAGTGTGAAGCGACCAGTGATGAAGCAAAGTCGTTCCACCCCTCCATATTGTTGCAAAACTG
GCGAATCAGTTCCTGCTGGAGAGTGGGCGAGCTGCAAATCTTCGCAATCTTTACACCAACAATCGCCAAATGTGCATCGTAAATGTGAGCCGAGCTGCTC
TTGTTGAGCTTGTGCAAAATGAACTCCAGAATGGAGTCCGGAGAGCGGAAAATACTGCGCAGGAGTGGGTTGTTCACGCGCCCATTTGATGTAGGCCGGT
TCAACAAGTTCAGGTACAGTTTGACTAGACGACAGTGCAATATGCTGGCTCTGGGAAACTTCTCAAAAATATCGATCAACGATGTAGCTAGATCCAACCG
GGTTAATCGGCTGTCGATGCGGTCGTTTGACATTCGGATAACAACATCCAGCAATTCCACCACATGCACCACAAGCAATGTCGATGCCAATGGCCGGTGG
TTGACCACAGTCTTCCCTGATCTCGGCGAATAACTGAGCGCTGGAGGCGTGATCCCTAAATACAAAGTACTCCGTCCAAGCGAGGCATCATGCTTTGCGG
GTTTGGCCGGGCTGGCGTTTCCATTTAACGGGATTGACAACTCAAGATCCTCCCCGCTGCCATCTTCAGAGTCGCTATCACTGAAACAATCGCGTGCGGC
AAATTCGGATATCGTAGACAGGTGCTGGTGGTAGTTGATAGACGCGCAAACCGTGTCCAAGACAAGATGAATCGGCGCGACAAATGTTTCCAACTGCTCC
GTGTCATGCACGCAACACTCGACAGCATGGCGCAGAATATCGATCACAAGGACTCGGGGGATACACGCGCCGTTTGCATGGTACGCATCCAAAAATCGAA
GTTCGGCCATTCCCAGTTCCGCCAGACGGACGAGAACGTTAGGCTTCTCCATTAACGCAGCTAGCACCGCGCACTTCAGTTTCTGGTGCATTGCTGGGTC
ACTTGGGGCTGTTCTCGGGGGGAAAAGCTCCCGCTCAAAGGGCCCGACACTCTCAAATGACGAAAGCTGAATCTTCGTCTGCATGTAGAACCGAAACGTG
TTAGGAAATTCCTCCTTGAGGATTTTGAGTAAGATCTCTGCGCAACCGCTTATCCTCGAATGTACAGTTGACGTCGAATTTGCGGTGAACAACGACGGCG
AAAGAGGCGCTGCCTTGGAAGAGAAAAATGAAGATGGCGATAACGTTGGTGATCCACCCAACGACGATCGTGGAGACGCTGACGAAGTAGACGAAACCGT
CGACGTAGAAGACACAGAGGACATCGATCGCGCTAGACGAGTCGGTACCTGCTCTACAATTCGCTGAACGAGGCAGCGTATGATAGGGAAATAGGAGAAA
CCGCGGCGGACAGACAGATGGATCAGGCCGTGCAGCAATGACGCGATGTCTGGGTTGTACGCATGCGCTGCCAGTCGCGATAGCAACCACTCTTTTTCCT
CATCCATATTTTCATCGCAAATCAACCTGTGCACCGCCGGAAACGTCACAAAATTCTTGGTAATGCGGCACATATTGGCAACCAAGACGCTGTCCACCTC
AACTTCTTCATCTGCAGCACTGCCGTTGTCACTTTCCTCGCCGTCAACCTTTGGCGTTCGCCACAAAAATCGGAACAAGCCCGCAAAAATCCGTTTCCAC
TCGTTCGCCGTCAAATCCTCGACCCGCAGCAAATATCCACGCGTCGTCGGGTCTTCCAAAAGATCCTCCTCCTCGTCCCCACTCAAACTAAAGTCCGAAA
TGCTGCTGTCCGAGCTTTCGAACCGCATACTCGCTCGCAGTCTCTGAATTCTAGCCATTTTTCTAGTCGACGCATTGCTCCGGAAGTCCATCATTGTCGT
CATGTTGGTCGGAGGCTTTTGCGTCGACGACACCGCCAGTCCTTCCAGCTTGACACTCGGTCCTGCGTCCTGTCCTTCGTCCTGTCCTGCGTCCTGCACA
ATGCCATCAGCCGTATTTTCTCTACTTTCCTGCGGGTCCTGCTTCGGTTCACCGTACCAAGCCATGGCTTTTAGATAAAATCGCAGGATAATCTCCGTGG
CCACATACGACTGGCGATATTTATCCGGATGCGAAACAGTTTCTTGTTTGGGTGCATTTGGGTCCTCGCTTTCGCCAAGTTGCCGGAAAATTGGGTGCAG
TTCACTAAAAGACGTGGCAAAGGCCAAGACCTGTTTGATGGACTCGGGCTCCAGCAGCAGCTTCTGCACGGGGGAAAAGTGCCCTTTTTCCCGGCGTTGC
ACCGTGGAGAGCACCGTGTCCACATCGTAGCAGCTGCAGAAGACGTTGTCGAGCGCGGGCGCCTGCCGCAGCGCCTCTGCGTTGTGCAGCGCCTGGGAGG
CCTTGAGCGGGTCGTG