Description :
From Genome Similarity Track
Location :
scaffold_442:105- 5052
Transcript NameFunction/comments
g8399.t1 reverse transcriptase
g8400.t1hypothetical protein
g8401.t1 hypothetical protein PHYSODRAFT_257355

Sequence
4947 bases(100 bases per row)
CGGTTACCCCACAGGAGATCGAAAACGGCGATCAAGTCCATTATCACGAGAGTGACGATCTTTCAGTCGAAGATCTCGCAGACAATCTCGCCGTTGTCCC
GGAAATCTAGATCTCGACTACGGAAGAAGTCAGGATCGAGGATCTACAGGTGGGTGATCCGGGATCGGCCACCCCACAGGAGATCGAAGAACTCCGGCAA
ATCATCTGGAAGAAGCGATATCTCCTGATCGGCAAAGGAAATGCACTGCCACCGGCCACTAGAGGGGTTGTATGCGATATCGATGTCGGGAATGCGAAGT
CGATCGCACAGCGAGTGCGTAAAGTAGCGCCGCAGTCCCGCGAGAAAGTGTCAGATCTGATCAAGGGACTCTTAGCCGCCAAGATCATCCGACCTTCAAT
ATCACCTTGGGCGTCCCCGATCGTGGTGATCATCAAAAAGAACGGTGTGGATATCAGGTTGTGCATCGAATACAGGCTGGTGAACGGCCTTACGAGGATG
ATGATCTACCCGATGCCCCTGATCAACGATCTACTGGAGGATCTCGACAAGGTTCTATGGTATTGCTCGCTGGATATGGCAAGTGGATTCTGGGTTGTGT
CAATGACCGATCGAGCTCGCGCGATCTCGGCGTTCATCACTCCATTCGGTCTGTTCGAGTGGAATCGTATGCCCGTCGGGTTGAAGAACGCTCCCCAGAT
CTACCAGCGTCTCGTGGATAACGCCCTATATGGATTCCTGAAGACCTCGCGATCTGGTGACTCAGAAGACTTAGCCGATGTGTTCGAGTCGGGGATCCCG
GAAGATCCAGGTCACCCATCGGTGTTGGGACGTAGATCATACATCGATGACATCATGATCACCGCTGGGTCATGGGATCAGATGTGTCAAGGGGTGGAAG
ATCTACTTGAGGCCTGTGATAAGTGGAACCTGTCAAGCAGTGTGGCCAAGAGCTTCTGGGGCATGAGTAAAGTGGAGTATCTCGGGCATCGAGTGTCGAT
CGAAGGTTTGGAAACGAAACCAAAGGATCTGAAGTCTCTGACTGAGCTACCATTTCCCGGATCACTTCGATCGATGCAGTCGTTCTTGGGAAGCTTGAAT
TACTACAGTCGATTCATCGAAGATTACGCGGTCTATGCCTCTGTTCTGTATGAACTACGTGAAGTGGAGTTCGCGGAACTGCAGAAACGGCCCGACTTGG
GGAAGATCATGGACCAGACGGTCCCGATCACGTGTGATCCCACCCCACCAGATCAGGACTTGAGCGCGCTCGATCCTCGATCCGACAGGTCAAGTGCGAG
ATCGGAGCTTGGAGACACAAACAACAGGTGGATCGGGGCTCACCAGGCCTTCGCGGCTTTGAAGATGAAGATCGCGACGACACCGATCCTGCGCCACTTC
GATACGACGAGATCACCTGTGGTGATCGTGTATGCTAGCGACTGGGCGATTTCTGCCGCGCTGATGCAAGAACACGACGAGATATTCCACCCGGTCGCAT
TCGCTAGTCGTACATTGAAGGTGAACGAGTTGAACTACAACGTGGCGGAGAAGGAAGTGCTGGCGTTGCTGCGGATCCTAGATCTCTACTACAATCTACT
GGTAGGACGTGAGATCAAGGTCCTGACCAGGCATTCCACGTTCGCCTGGCTATTCAAGTCGGCTGGGCTCCAGGGTCGCCTAGGACAGTGGTCAGCACTC
CTGTCGCCGTGGACGCTCGAGATCACGAAGTGTACGAAGGGTGAAGATGAGATACTGGGGGCGATCGCGGCCAGTATCACACCAAGATCCAAGATCGACG
AGGCATTAACCGTGATCGCACCTCGGAAGGAGCCTAAACGCCGGATCCAAGCGCCAATCCCCACGGTGGATCGAGATGAGGAACTATGGGTTGTGAGTTT
CGATGGATCGGCCCGTGTGAAGCGAGGTGGGGGCGCCTTCAGCGCGATCGTGTGGAGTCTGCCCGAGTGGAAGGTGATCAAGGCGAGATCAGGCTATACC
GAGAGTCTTACTGTCAATAAAGCCGAGTATAACGGCCTATTGCTGGGACTTGGACTGGTGAAGGACCTCGATCGTCGTCGATTGGTGATCTGCAGTGACT
CTAACCTCGTGATCAGGCAGGTTCGTGGCGAGATCGACTGCAAGGCGCCGGGATTGACGTTATTGAAGCAGAAGGTGCTTGATCACCTGAGGAAGTGGGG
TGATCACGAGCTGGTGCATGTGAAGAGAGACTGGAACGGAAGTGCGGACAGCTTGGCGAGTGCGGATCTGCAGCGGCGAGACGGGATCGAGGTCCACGAT
GACGTGGATCGCTAGGACCTAGTCACCCTTAATCGGCTGGACGAGGTCCTGGTACCCAAGTCCGACGATCCAGTGGTACGGGTCTCGGCGGTGGCTACAC
GGGCCAACGTTCGAGCTAGATCCAACACCACCGTCTTGCAAGAAGAGTGGTTCCGAGAGATGCGGATAGATCGGATTAAGCGAGCGCAGGATGAACAGGT
CTGGGTCGCGGGGATGAAGAAGTACCTGATCGGGCAGATCGCAGATCTTACCCAAGCTGAATCTCGATCTTATGGCAAGATCGCGACAGACTACGAGGTG
GACGAGCAGGATCTGCTTTTCTATTGTCCTCCTACGACGAGATCGAGCGATGGTCGCGATGGATTGATGAGACTGGTTGTTCCGGAAACTCTCCAACAAG
ATACTCTACACCACTATCACACAACCTTGGAAGGCGGCCATCAAGGGATCGGCCGTACCTACCAGTGAATCCGGGATCACTTCCACTGGAGAGGTCTGTA
TCGGAGTGTGCAGAGATATGTGGGTGAATGCGTAGAATGTGAGACTGGCAAAGGAAGACCCACGATCCAGGGTGAATCGCCTGTAAATCTACAGGCCACT
TACCCATTCCAGATCATAGCGATGGATCACATCCCGTCCCTGCCCAGATCCAACAAAGGCAACACGGAGTTGCTGATCTGGGTCGACCTGTTCACGGGAT
ACGTGGTCGCGAAAGCTAGCTCGTCTCGATCAGCTCAGACCGTCGCGGAGTCTTATGAAGAGTGTGTATTCCGACGATTCGGGGCGAGCGAGATGATCCG
GCATGATCGAGAGCCAGGATTCATGTCAGACTTCTTCAGATCGTTCAACAAGATTCTGGGGCAGCGACAGCGCGCTACGATGGCGTATCGACCTCAAGCC
AATGGAACCGCGGAGAGAATGGTGCAGACGGCGACTAGAGCGCTCAAGATGTATGTCCAGGATCTAGATCAGAAAGACTGGGACGAGTATGCCGAGCGAT
TGACGTTCGCGATCAACACGGCTCACGATCGAGTCCGAGGAGATACCCTCACTACTTGGTACATGGGTGGGATCCGAGATCCACGTTGGAAGCGACAATC
CCAGTTGGATCTACCAGACGACAGGATCGCGATCCACGCCGGTGACGCTATCGGATCCAGCGATACTATCAGCAGTCACGAGAACAAGTTAATGCCAGAT
TACGAGACGCGATCTCGGATCGAGCTGATCGACACAACGAGAATGTGGATCCACATCAGATTGAGGTTGGGTCTCAAGTCTGGCTGTATCTCGATCGAGT
GAGGGAAGGTTACACCCGTAAGCTAGCCCACCTCTGGCATGGCCCATTCCGAGTCGCAAAGAAGATCAACGAATTCACGATCAAGCTCGAGATCACGGGA
ACTGGATATCATATATTCCCAGTGGTCCATGTCTCGAAGCTGAAGCTGGTGCGGGACTTCCCTGATCGACCCCGGATCGAGCTGACGGTAGATGAGTCGG
ATCGCCTAGACTTTGACGAGATCCTGCTCCCTGAGGACAGCTGGGTCCCGGATCTGGAAGCTGGCGAGTACCAAGTTGAACGAATCTCGGACATGCGGAG
TGGGAAGAGAACTCGTTATGGCCGGATCTATCGAGAATTCTTGGTACATTGGGTTGGTTACGATGAACCAACCTGGGTCGACGAGGCAGATCTCAACTGT
GGAGCCATACTGAGTGCGTTCCTGCGAGATCACGTGAATCGCAACCGATTCGGCGTGATGCAGTCGCATGAAGAGGTGTAGCAAGACGATCGGTGAGTCG
AGGCGGTCGTCTCACCGAGATCCAGAGGGATGATCTGGAGGGCGATCCAGATCAAGAAGGAGACTTTGAAATTTGTATATGCATGTGAAAACAGGAGTAA
TCAAGGTCGGTGGAAGGTGATCTCGAGTGGTTAAGTGGAGATGAAGTGATATCGCGATATGGGAATCATGGAGAAGACAAGAAGAGCGTGGATCACAAGC
TATATTTTCGAATTACGTGAGAGAACGGATGAAGGCTAGACTGAAGCTTGGATCATGCATTATCGGAGTGGAGCTCGAGCTGGGGTGAAGAGATCTTGGA
ATGTCGGCTGGAATCTCGCACCGTGCGGCTCAGGCTGGACGAGATCGTGAATTCATGGGGCCGGGGGCGCTCCGGCAGCAGCTGGAGCAGGATTGAACTT
GTCGGCCAGACGCGGAAGCTGTCGTGACGGATGATCTGCAGGAAAATCGCGATAGTGATTGCGCCAAGGGTCCATCTGGTCACACTCGATCAGAGCCTCG
ACTAAATCTTGGGGCTCAGGACGGTGTAGATTGGGATCTTTGAGGTTCTCGGCGCGAGAAGCAGATCCGGGGTACCAGTGTACGCTGTCGCCTGGGGTGA
GCGGGAAGTGCATGAAGAAGGGGTCCAGCAGTATGTCGATATCGCACCACTGATCTCGCATTATGGGGGGGGGGGGGGAGGTGATGACGAACGCTCTCCA
AGCGGCGCCAGCTCGACTCCGACGGGCCCTGCGAGCTGCGTAGTACTGCTGCAGGACAGGATCCGCAGCCTGCATCGACGCTGAGATCTCCAGGTAATGG
GTCGATTCCCAATACGCCTGCCTGTGCCGGGCTTCCAAGTTCAGGTA