Description :
From Genome Similarity Track
Location :
Scaffold_839:105- 2930
Sequence
2825 bases(100 bases per row)
CGTCGTGGACGACGCGGTCCTAGAGGACCCAGAAGGCGCTGAGCGCAGAAGTGATCGGCGATCCTCAAGATTCTTCGGATCCCTCTACCGGTGATGAAGG
AGTATGGAGACGTGTCTCAAAGACCACGACGGGCCTGCTCCGGATAGAGCGTGTGTCATGAGATTGACCTGGTTCCTGGACCAAATACTGCGTAACAAGC
AATGCCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACA
CCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTC
GCAAGGATGTTCTGCAGAACAACATGGTAGGCCTGTACGCTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACA
TTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCAAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGT
GACGCAGCTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAAC
CACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCC
TCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCAATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAA
GTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGC
TGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTGCCGGACCCGGATAGTCCGTTTAGCGTCG
TCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAGGGCGTGAACGCGTGATCGCGTTGAGTCTCGCCAGCTCAAAGCTG
CGGAGAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATC
TTTACTGATCATGCGTCGTTACGCACTGCGGACACAGGCACCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAG
GTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATACGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGC
CTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACAGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTC
TGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCTTCGTGTGGTCGTTCCTCAT
GATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGT
ACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATTTACGCACGTGTGAGACGTGTCAACAGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGC
GAGTTTGCCTGTCCCCAAGAGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAGACAGGAAACACGGGCATTGTGGTCTTT
GTAAACCGATTGAGCAAGATGGCTCATCTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTACAGCTTTGCTGATTTTAGACCGAGTCTTTCGCCAAC
ATGGCTTGCCTGAGGCAATTGTCTCGGCTCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTC
CACAGAGGACCATCCACAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTTGAGGATATCCTCCGAAGCGTATGTGCTGAGGCGCCAAAACGCTGG
GGCCAGATGCTCGCACTCGTTGAGCTCGCATTAAATAATGCAGTGCACTCCTCGACAGGCTACACTCCGCTCTATGTGAACGGCTTGGTTAACCCTCGCG
TCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGATGGGGAAGAGATAGCCGAGCGGCTAGCTGATGTCAGCCATGTTGCGGCTCGCAAGCAAGTCAA
TGACTTTGTCTCTTTGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACATGCAAAAAGAACATGCAGATGCCAAAGGCAGA
CGCAATGAAGAAAGGTTTGAGGTCGGAGATCAAGTTTTATTAAATGCAAAAAACCTACCTACTCATGCAGTGTCTGCGGTCTTTAAGACAAAATTGAGAC
CACGGTTCATAGGACCGTTCAAGGTCGTGGCCAAAAAGGGCCTAGCGTATACGCTTAACCTTCCGAAGAAGATGCGCACGCATCCAGTCTTCTACGTTGG
CTTACTCAAGCCGTATCAGGACCCT