Description :
From Genome Similarity Track
Location :
Scaffold_1529:105- 2789
Sequence
2684 bases(100 bases per row)
TTTCCCTGCACATGAGCGATGAGCCCGCGTTCGTACTCGTCAAACGCGCTCACCCGCTCGGCCTGCTCGGCTGGCGTCGCCGCCGCCAAGCTCCGGAGGG
CATCTCTTCCGAAGATGCCCGCCATCTTCCGCACCGACTCGAACTGCGAGTCAGTCAAGTGTGGAAACTCACTTCGGTCCATCGTGGCTCACAGACCTGA
GCCACCGAGGATTCAGGTAGACCAAGCTACCCGCGTAGGCGTAGGATTGACTACAATTGCTACCAAGTGTGATGGAGTCACACAGCACAATGCACAGAGG
AAGTGCGTGCGGATATTACTATCCAGGTGAACAGCAGTTCACCAGTTCCCGGCCTCAATGGGAACGGTTTGCTACAAACGAGTAGGTTATAAGACTGACT
GTGTTTTGGTAGAGGTTAACTTGGTCTTAATACAAACTACAAGTTAACTATACAAAAGCCCAAACAAACTCAAATGGTTGGCTTGCGGAGCTACTGGTAC
CATGTACCATGTACTCGGGAGAGTGACACCCGTCACTCTTCATGTAATGGGTACACTTGATTGTACCCCGTTACATGAAGAATGGGTAGATGTTGACGCC
GATGCTGTCCACGGTGTTAGCCAGCTTCCACGCGTCATTGGCGCTCAGCCACTCGTTGATGCGCTGCACCGATCCGATGGGCGTCTTGCCCACGCAGCTA
CGCACGCGGTTGATGAAGCCGACGAGCTGGTCGGCCGAGTACTTACCGAATCCATTGTTCTGTAGGTCTTCGTTGCCGACGTAGACAGCCTCGACGGCCC
ACGGGTTCCGTGCGTAGCCATCGCAGACCACCTTGATCTCAGCGTCGATGCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGTTCCGGTCGAGGGCGGAGTTTCTCGACCTGCAGCAGGGCAAGCATGATGTCCA
TGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGACTGAGAGAT
GGGCCTGTGAAGACCTATCTCTTCCGCGAGTACTCGAGTACTCTCGAAGATGCAATCACTCTTGCAATGCAGGAGGAGTTTAGC