Description :
From Genome Similarity Track
Location :
Scaffold_2153:105- 1563
Transcript NameFunction/comments
Phypl_g14744putative polyprotein

Sequence
1458 bases(100 bases per row)
gCTCTTCCCAACCCGGGAAGGCAGCGTCCACAGACGTACCGCACGTGAGTGCCCattctcgcgctcggccaccGAGCTTAGAGATCGCCAGCGCCCCACG
CTGTTGCTCAGTATGGAGCATGGCTGATCCCATCGCCATTTCGATCTGACGGATCCATAGCATAAGGATCTCCCCCTCCTTTCCTTCGAAAGTCTTGACG
CTGGTTTCGGCCAGGGGGCCCATcctgcgctgcagtcgacgccgtcgacggcgcagTCGCAGCCATTCTCTGTTGGaggtgctccagcagagcATTCTCA
TAGTTAGAGAACGCTTCTAGACGCGTGTTCACCGCGTCCGGGCCTTGCGCAGCAAAATGCGAGCCACCCTCAGGGCTCAGTAAAGACATAAGCATATTAA
GCGCGACTTGCTGGCCAGGAGACAGGTTCGAAACCGCTGTCTGATCCATCCTCACCGTGGAATAGTCCTAAGACTCAGGTGCGCGATTGACTACAAGTGC
TATTAggtgcagcggggctgcgtagcgtagtgcatcagaggaagacgtatgactctccgagtctcagctgACGATTCTCCGAACCGcaaagtctccgcag
aggcttaaATCTCTCTAGTAAAGTATCGAGAGTCTCAAAAAGTCGGTATTtctaacccaaggtaaatacactctttgatgctaaaactgaactgcTATTG
CGTTCTTTATCTGCGGTAAAGCGGCCTGTATGACTCTAACTATCTACCGTAGTTAAACCTAGTAAAATGCATATCaagtggctctgaagccacgtactga
aatcctgttaatagaagtGGTACCAAGGACACCctccgtcaaggtggcacgtagtgtggctacacttcgtgcgaccttcgtgtaaccctGTGACAGACTG
CTTCGGGTTGTGGAGATGGTGGGTCGTCACGCCACGCGGTTGGAGACCACCGGGACGGAGTCTCGTCTGTTCTCTAACGTACACATCTCCAATTTGAAAA
GAGTTCGCGCATTTCCGGATCGCTCGGAGGTAGAGCTGACAGTGGACGAGAGTACCCGTGTCGATTTCGACGAGGCCCGCCTACCCGAAGACGCAGCCTC
AACGAGGATGATAATGAGGTTGAATGGATCGTCGACATGCGAACCGAGCGATGTATTCGGTACGGCCGGGTTCATGACGAATTCAAAGTCTACTGGAAGG
GGTACGACAACCCATCGTGGGTGGATGAAGCCGATCTAAATTGTGGCGCCTTGTTACGGGAGTATGATCGCGAGATGGTCGCCCGCAATCGTTTCGGATT
TAAGCAATCGCAGGAAGAGGCGGTGCAAAGCCCGTAGCAGGTTGGCTGTTACGAAGAGGAGTGGGGTGAAGGACGTACAAGATGGTCGTTCGTTTGAGGA
GGAAGGGCCTTTATGTGATTATGAGCTGGGAAGTCAAAGATTCGAGCTGTTACAGCTG