Description :
From Genome Similarity Track
Location :
contig_31:104991- 106386
Transcript NameFunction/comments
g6056.t1hypothetical protein PHYSODRAFT_565202

Sequence
1395 bases(100 bases per row)
CCGAGAAGCCCCGAAGTTCTGGACTACTCGGTGCAAATCGTTGTAAACGGCCGAGTCGATCGTCTTGGGAAGGAGGTAGTCATTGACGAACTCAATGATG
TGTGGAAACTCTTGCAGCAGTGGGGTGAGCGCGAACGAAACGATAAGCAGGAGTTGAGGCTTCTCCATCGTGGGGGAATTGTAAACTGGTATCCGAGCTC
AAAAAATAGTTTGACGAAGCTAGTCAATCAAAAGGTCAATTGCTTTTATTTATATGGTTGAGGGCAATGGCTAACGTCAATCATTTGAAAAGGTCCCGCA
AGTATCAATCTTCAAATCGAAAAATGTACCCATCTTGCTTCGTCTTTCGCCTTCCGCAACTCAACCATCTAAAGTTGCCGACTCAGTCTCTCAGAATGAT
GGTCTTTGATTCTACGAGCTGACACGCCCATCTCCCTCTATTCAGTTCGCAACGTATCCGCTCAGTAGCAACAACATGTCGGACGCGACGCCGTCCGTGG
CGCGTATGCGGGCCATCCTGCGCCAGCTCTCGGCCGGAGGTCGTCCCGCCGCCTCCTCCTCCTCTTCCTCCGCTTCCCCTCCATTGGCACTGAGCCCCGC
CACGCGCTGGAACGGCTGGGGCTTCCAGGACACGAAACTATTCGTGAACTCCAGCAATGTGATCGAAATCTCGGGTGCTCGCTACGCAGAAGTGTTCGCC
AATGCGCCAGACCGCACACTGCCGGCTCTGCTTCCATGGGCGGAGAAGCGGCTCGGTCTGGACGCGGGTCGCGGCAGTCCGCCGAGCGTCACGTGCGCTG
GGGAGCTGCAGCTGCAGAACCAACTACCAGAGGACGGAGAGACGCACCGCAAGCTGCTGCAGCTGCTGCAATGGGCAGAGCAAGAAGTCGGCATCAAGAG
CAGCATTACAGTTGAAGAACGCGTCCGCCACGGCCACGGACAGACGTGTGAGGACGTTTTCCGACTGCGCCATGTGCAGCAAGTGGAACGAGTTCCCGAC
GCGGTGCTGTGGCCCTCGAGTCATGAACAAGTGGAGGTTTTGGTCAAGGAGGTGACGGAGAAGTTTGCACACCAGGTGTGCATTATTCCGTTTGGAGGGG
CACCAACGTGACCAATGCGCTCGAGTGCGACCCGAAGGAACGACGGGCGATTGTGTCGTTGGATCTGGGCGAAATGCGACGCATTCTGAGTGTGGATCGG
GAGAACATGTTGGCGGTGGTGGAGGCCGGGATCACCGGACTGGATCTGCATGAGCGGCTAAGGCATCGAGGCCTGACGCTTGGCCACGAACCGGACTCAT
GGGAGTTCTCGACGCTCGGAGGGTGGGTGGCGACGCGCGCCTCCGGCATGAAGAAGAACACGTACGGGAATATTGAAGACCTGGTGGTAAATGTT