Description :
From Genome Similarity Track
Location :
Scaffold_13:10497- 12375
Transcript NameFunction/comments
Hyaar_Emoy2802400endo-1,3(4)-beta-glucanase, putative
Hyaar_Emoy2802401Amino Acid-Polyamine-Organocation (APC) Family

Sequence
1878 bases(100 bases per row)
TCGATCACTCTTCTCGTCCGCAAACTGCAGCTGCAATGTCCGGACCCTATCAAAGTACAAGATCCACTTTTGCTGCGACGTGCCCATTCCACGAGCACTC
ACCCCCGTACCATAGACTTCCACATCCAGTTCAAAGCGCTTGCTTGTGAACGTTGGCAAGTCTTTCCACGACGTCATCACACCGTAGTCCACTTCTTGGT
CCACTATCTTGCCATTAATGACCACGACCGTCGCGTTCAGCTCCAGCACGGGCAGCACGTCATGGTACTCGACCGTAATGTACGGCGAGCCCCGGACGAG
AGGCACTTTCATCCACTTGTTCTTGCTCACGTAATCATATTGCAACGTGACCGACAAGACGTCAAAGGCCACAACCCGTCTGGACGTGCTATTGCCGTGT
CCTAATAGCACCAATGGACCCGCTGCTGCCTGGTCCTCCAGTGCCTCATTCTTGTGACTGTAAGCCGTGAAGCTCGCGTCGACGTTAAAGTACTCAGTGA
TCGCGTCCTTGGTCGCCACGCGACGCGAGTCTCCGTACGAGATTTCCAGTCGCTTTGGCAAGCTCCGGACTGTATACGGACTTAAGGTGACCTCGCCACA
GCCAGCATTCAACCCGTGACCGTCTGCGACAAGGAAGTTCGACCAGAACGCGTTCGTGGGCAGTGATTGGCCAAAATGCTCGCGAGGAAGCACGAGCTTG
GGCGGCACGGGGTGGCGCTTCTCGACAAATAGCGGCCGCATTGTGAGCAGCTCAATAGTAGGGTCTACTGGACGGGATGTCAACTGGGAGGTGTCTGGTC
GGTGGCTGCGGAAGAGGAAGCCGGCGGTGACAAAGGCAGCAATGAGAAAGACGGACGTAAGAGCGTACAGTGCATGACGGAAAGGGGGGCGGAGGCTGGA
GACACGACGCGGGAGCAACGGGGACGCTTCATTCATAGCCATGATACGAAACCACTTGTGTCGGACGTGGTAAAATCAGAAATGATTGGGATATCTGAGT
TCACACGGGTTGGTCGTAAGATACGCATGGGAATTTTGTAAATTATAGGCAGGACGGGGTTTTAGCCAATGTGAATGAAGCGATGATAAAGTACCGGTTT
GTTATATGCGAAAATAAGAATGGGGAGCGAGTACTGTACTGATATAAGACGTGCATGATTTTTATTGCGAGGTACAAAAAAAGGAGATCGAATTCTTGCT
TTTTTAAAAAAGGTTATGAGCTGACAGCATTAAAAAAGCGGATCAAGTACTGAAATTAGGGATACGTCATGAGCTGTTCACAACGACCGGCTGCGATAAC
AGACTTGTGCCGTACATGGTGGGAATAGTTGTCGAAGCGCGATCGTAAGCGCAAGTGCCTTGATGCGCTGGATGGAAGCGGCGCCAGACAAGATACACGC
TGGATACAACCACGTTGAACAGCCCGCAGAGGACCCACACACTACGCTTTTGTGCAATTAACACGCCCAGAAGCACGACGATTTTCGGAAGCGTAATCGC
CCACGCGCCCAATCTGCCAAACGGGACCACAAATGGACGCTCGGTGTCGCTTTCCACGTACTTTAGGCGCAAGAACGCAAAGAACTCCAGCATCAACGTG
AGGCTATAGTATGCAAGCCACAAACAAACAACGTGTTAATATGCTGCGCACCTGTTCATACTATAAAACATATACACGAGGGACGACGTACTTGTTGAAA
AAGGTGTCAAGCACCACCAAGATCTCGAACGAAAAGTTCATGAGGATACCTGTAGTCACTGTCTGAAAGATCACTGCTGCCACTGGCGTCTCAAAGCGCT
CGCACTCAAAAACGAGAAATGACGGCAGCATCTTGTAGTCTGCTGTCGCCCACAACGCACGCGAGCTGCAAGCCATGA