Description :
From Genome Similarity Track
Location :
Scaffold_4:1049568- 1056776
Transcript NameFunction/comments
Physo_128409reverse transcriptase

Sequence
7208 bases(100 bases per row)
TGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTCCGGGACGACACCACGCGCGCAATCGCTGAAGCTCAATGTG
AGCAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTTGAACTCGACACTGCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGG
TTGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACGCCGACTCTCGGATCCTACGTGCTTTAGCACGTAGGAGGGTTTCAA
GGAAGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTTCTCGACCTGCAGCAGGGCAAGCATGATGTCCATACTTAC
GATCAGAGAGCACGATACTGGGTCTCTAACGTCGTGACCAATCCGATCGAGGCGACCAAGGTCGTCACGTTCATGAAGGGATTGAGAGGTGGGCCTGTGA
AGACCTACCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATACAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACA
TGTGCCGAGGCCACAACCACGCCCGGTAGAGGACGGGAGGCCCAGAACCCATGGACTTCTCTAGTGCTCCAACTGCTGGACCCCAGCAGTCGCAGGGAAA
CAATGTGCGATGCTACCGTTGCGGTAGCGCCGGTCACTTTGCTTGGGAATGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCAC
CGTCGCAACCAAACAAAAACGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGATCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGGT
TCATTCTCACTGCAAGAACCAAGATGACAAACCTGACCTTGTCATCCTGAGCGTGAACTCGATGAGAGCAAGCAGCTCTCTCCGTGCTTTGGTAGATTCT
GGCGTGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACATCGAGGATATAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGG
GTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATTGTCCTGGATCTGGACGATAA
GTTTGACGTTGTATTGGGCATGACGTGGTTTGCAAGGCATGATCCGGTCATCGATTGGGAGAAGCACACTCTTTTGCGCTTCGGTCGCGACAGCGGAACA
GTGAGCGATGGCCCTGTTGCCGCAACACACGCACTGACAGGTGCCACGCGACTCCCCACTCGAGGCAGCGCCTAATGCCGCTGTCCCGGAGCACCCTAGG
CGCGGGCGAGCACGCGCGCAAGAGCAGCTAGCGTCGGCGTCATGGTTGGTGTCGAAGTATTAAAGTCGCGACGGTTCCGGGAACCGGCGCTGCGAAAAGG
AATTTCGCGTCGACTCCGGGAGTCGACGCACCCTTTATAATAAAGGGCTCCGCCAATAACAGGCGTTGAGGTGAGAATGGCGTGTCGGCTCCGGGAGCCG
ACGTTGCAGGCGGTGCGGACGGTTGCAAACGTCCCACACCGGAACAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGTGAGACCAAGC
CGGGCTTGAAGTCGCTCGCCCGCGGGATGTACCCGCCCGCGGTACTAAAGAAGAAAACCCGTGCACGACTGGGCCTGGACGAGGTCAAGAACCAAGCGGA
GCCGGGCTCCGCAAAACAAGAAGACGGCGCAAGCGAAGGTCGCTGCACAAGTCTCGGCCCGGGGCCGAGACGCTACGCGGAGGCTGAGGAGCCGGACGTC
GAGACGTTGAACGTCTTGACACGTACCTGTGCTGGATTCCGGTATAGGGAGATGACTCTCGCTAATCCTCCGACGCAAGCGTCGGAGTTGACTTTGCTTC
CAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAAGATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGA
AGAACTGAGGCAGTTCTTCATGGAGAGCACCACTGAGATTGAGGACACTCTCAGTGCAAGACTAAGAAGGAGCGCTTTGAGGAGCAGAGCTGGGACTCGC
TGAAGACGAGTCGCTTCTACGAGATTCTACGGGAGCACGCGGACATGCTTCCGGTAGAGATCCGTGTGGAGCTTCCGCAGGACAAGGGCATCCAGCACGA
GATTGATTTCGTGCCGGGCACGAAGTATTGTGTCACGCGGCAGCGGCCACTGCCGCGAGAGCAGGTCGAAGCGATCGACGACTTCTTCAAAAGTTGTCGC
AAAGCTGGACAAGTGCGGGAATCGAAACCCCCGCACAGTGCCCCGAAGTTCTGTGTCAAAACGCCACACGGCGACTGGCGCATCGTTTATGCGTACAACA
AGCTGAACGATGCGACGATACCGACGCAAACACCGATACCGCGAAAAGATGCCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTCATCT
GCGCAATGAATTTTATCAGTTCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACACCAAGCGGCATGCTCTGGGAGTTGCTGGTGATGCAA
CAGGGTCTGAAGAACGCCCCTGCGACTTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGTGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCG
TCCACAGCGGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTTCGGAAGCTGCTTGGGCTCATGCGTAAACACAAGCTCTATGCGAA
CCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCATTGGGAAGAACGGTGTCCGCCCTGACTCTGAGAAGGTCAGAGTGATC
AATGAGTGGCCGACGCGGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATAC
GCCCACTATCACAGCTCCTGAAGGAGGACGTCGAGTGGGTTTGGATTGCTGAGTGTCAGCAGGCCTTCGATGTAGTCAAGCAGGGCTTGACTGAGGCGCC
GCTCTTGGCGGTGGCCGACCAAGATCGCCCGTTCCACGTTGGGTGCGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGTACGATCACGAGGGT
AGTGATCGTGTGGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCCCAACTAGACAAGGAACTCCTTGCCGTGAAGTATGCACTCGCGAAGTTCCG
AGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGTGTCGCTGCGGACGGCTGTGAAGTTGCCGCACATCTCGCAACGGATGGCGAGA
TGGCTCTCATTTTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGACGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCA
CGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGTTGGAGGACGTGAAGGTCGCGTACGCGCACGACGCGGA
CGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCAC
GACGGGTTATTTCTCAACAGTGCAGTCGACGACAACGCGGTCCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGCGTATCACG
ATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCAAGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGT
CCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCATTACCAACTCCACGGGAGTGTTGGCAGTCCATGTCT
TTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCATGGGAACGCGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCAGTAC
CCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCG
CTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGC
GTGAACCGCGTGCTCGTAGACGTGCTTAATAGCTACACCCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGACGGAGTTCGCCATCAACAACTCGG
TGCATGCCTCGACCGGGCATACACCCTTTTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTCAAGTGGGGG
AGGATCTACGACTGCAACACAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGAACAAGAAGCACGCGTCTGTG
CAGGGCACAGACGAACGCAGAGGCCGGGACTACTGCTAGAAACGAGCTGAACTAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCACACAAGCCGTC
ATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTTGATCGACAGAAGCTGAACGCAGACAACGTTGGCAGGGGCAACACAAATGAATTCAAGAAGGGTT
CATTGGTTCTGTTAGCTACTCAAAACCTGCCTAAACATGCCGTTTCCGACTTCGGGGCAAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGTT
GGCACGGCATGGCAAGGCCTACACACTAGATATTCCATCTAGCATGCGCGTCCATCCGACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAG
CCACCTAGCTCGGCTGGCCCGAAGCGGAAGCCCCAGCGGGAGCGAATCTCTGCTCCAGCACGTGAACGCGCTGGACCAAGCGTACGACGCGACCTCCCAT
GTGGACAGATATGTCCGACGCGGTCTGCGAACCCTGATCGACTTGAGGCCTCAGGATCGCCACCTCCTGCTTCAGAGCGGCGAACTCCCGGCTCTGAAGC
TGCTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTTAACCCCTGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGC
GACGCCCGCGGCTCAATACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCACGAAAACAAAGCGGCAGCCGGTTTGTTATCGTATTCGTTGGAGAG
GGTTTCCGCTCCACCAAGATACATGGGAGCCGCGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCTCACCACGCACTACCGGC
GCGAAGGTAGTGCGAGCGCTGTAGTCACCTGCAGCGCCCGAAGTCCCGCGATCGTCGCGTTCCTCGCGTGCCAGGAACTTGGCACGGAGATCCTTGAGAC
TCGCAGGTACATGAATCGTCGTGTACCAGTTTAGGTCGCGGTCGCTCAAGCGCGCTGCACCCTGAAGACACAACGTGCACTGTTGGCCTTCGGGCACAGC
GCATGGAATACCAGAGTCCACAGAGGATCTGTGGAGCTGCTCCAGCCTTCCGCGCGTCGAGAATGTCTCGAAGCGTTCACGGGTATGCTTGACCGGCTCG
CGGTAAGCAGCCGGTTTCTTGTTGAAGTTCTCAACAAAGGCATTCCAACTTTGACAAAGTGCCTGCTACTCAGGCACTTTGCTGCGAGAAGAGGTCTTCT
TGCTGGAGAAGTACCGGAGCTCGTGGAAGAGCCCGATGTAGTAATCGGGCCTTTGATTCGTTAACGTATCAAAGTGCTGCTCCTCCGCCACAGCATCGTC
GTGGATGCCGCTGCATACGTACAGCGGGATTTCATTTGGAGGCACGGTGTTGCCCACACGGTCTGTGATCTCTGATGCAGACGGCATCCACGGATCGCGC
GCTGCTCAGACAGCGCGCGGAGAACTTTAAGACGCCACATCACGCGAGGAGATTAAAGCCCCAGCAGCAGAGAGTGGAGTTTCGCTCTCGCCGCGCGAAC
GTTTCGAGCTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGACCCGCACGCCGGGTCGAGACTATCGCTGACGGTAGACTCCTTGCGCTTGCT
TGAAGAGACGTCGCCCTCTTTCATCTCCACGTCGCCGTCCCCGTAGTCAACGGCGTCGTTGACTACAGAAGAACCTTCGAGGACAATCTCCGGCTGGGTT
GTCCCCGCCGCAGCCATGGCAGCAAGAGCGTCACGCTTTGCTTTATGATGCTCTCGGTACTCGGGGATAGAGAGAGTCTCTATCCCGGCGGAGGTATGCC
CCTCTGCTTAAGCGGCGGTCTTCTTCGGCAAGCTCATTGCAGAATGAGCTCAAGCTTTCCTTCTTGCAACGTGAAGAATTGACGAATGGTCAATTTCCTG
ATTGACGTGCCGTAACTCGGCGCGTCTAACCTTGAGGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGACTGCAGTCACTTGTAACTCTTACAGACA
CGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAATGCTACATACATTTACGATCACCACGACGGGTGGTCCATAGAGAC
TTAGGATTCCTAATGGCTGAAAGCAGCATCTTTTAGCCAATGAGTGGCATGCATAGCGTTGGAATTCTCGTTGGCAGATTCCTAACTTAGATTATTACAT
TTAGAGGAAGTCAGAAAGCATAAAACAAAATAGCAGTTCTCATTTTAATCCAAACACATTATTTGGATTGTTTATTTAGATTAATCTATACTCGGAGGTC
CGAGTATAATTAACTCTAGTTTAAACTAAGCTGCGCTTCCTCACACACGTGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGACCATTACATGT
ACCGCGAA