Description :
From Genome Similarity Track
Location :
Scaffold_272:10494- 11675
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_272-fgenesh-gene-0.1Regulator of chromosome condensation (RCC1)

Sequence
1181 bases(100 bases per row)
GCGTGCGCCTGGTCATCTCTCGCACTCTCTGGATCACTCACGCTGGACCGACCTGTCAGAATATACGAGCTGTAGAACCCAGCTGCAATGCACACAACGT
CGTCGTTCGACAGCGAGTTGGACGGTACTGGGAGCGGTAGATCGGCGGACGGCAGCGTTCTCGCCCCCGCGCCAAGCTGTCCTTTGTTGTTTCGTCCAAA
CACCATGACTCGTCCGTTCGCTAGCAAAATGAGCGTGTGGTAGCAACCGCAGGACGTGTACTTGATCTTGGACGAGAGCGGGAGGGGCACATACTGTGGC
ATGTTCTTGTGGTCCTTGCTACCAATGCCCAGCTGACCGTAGTCGTTTCTCCCCCACGTGATGAGCTTTCCTTTCTCCGTGATCACAACCGTGTGGTAGT
ACCCGCAGCTCACGTCGACGATCTTCTCGTCGCTGTCGCTCGTGGAGATCTTCACCAAACTCGGCACTTTGACATTGCGAGCGTGGCCGAGACCGAGTTG
TCCATAGTCGTTCTTGCCAAACGAATACACTTCCCCTCCGGCCGTCACAGCGACCGTGTGGTACAGGCCACACGCAACCTTGATGATGACTTGGCTGGAA
ATGGAATCAACCAGTTGCGGCGTATGCTGGTGCTGCGTGTGGTCGAGGCCGAGCTGACCGCAGTCATTCATCCCAAACGTCAACAACTCACCGGCGCTCG
AGACAACTGCACTGTGATGATAACTGACTGCCGCGTACGTGATGTGGTATTTCTCGCGCAGAGAGTCAATCATCCGCGGTGTGTGACTCTTGGAGATGGT
CGATCCGAGACCAAGCTGGCCTCGGTCGTTGTAGCCCCACGAGTACACTGCGCCGTCCGTGGCAACTGCCAGCATGTGTTCACACCCGTTCGCCGCTGCG
ACGAGATCGATCGAGACCCCACTGAGCGCTCGTACGGGTGTCGCCAAGATGACTCGCTCTTCAAACGTGCCGTTACCGCACTGCCCGCTCTTGTTTAGGC
CGCAGGTGAAAACTGAGCCATCTTTCATCACGACCGCGAGAACTTCATTGCCGCCAACGATGCATCGGACGCTCTTCGTGGAGAAGAACGGTACGTGCTC
CAGCTTGCTTGTCGAGTTGCAGTGTCCGAGACAGAGCTCGCCGTAGTTGTTTTGCCCGCACGAGAAGAGCTCGCAGTCGTC