Description :
From Genome Similarity Track
Location :
contig_109:104915- 106218
Transcript NameFunction/comments
g11190.t1hypothetical protein PHYSODRAFT_246627

Sequence
1303 bases(100 bases per row)
GCAGCGGGGGTCGATACCTCTTGATCAGGAACGGGGACATTCTCGGAGCTGTTCATGATGAAAGCCACCGACGCCTTGCTGCTGGTCGCCATTGCACTCA
GCTCGATCGACGTCTCTTTGACAAATGGATTCCTTGCGTCGAGCTGGGCGAGATCTCATTCCTGCATCAAGCTGAGGCCGCCGGGAAGCGTCACTTTAGG
TAGCGAGCGAGGATGCAACTGCTGACCAAGCTGCTGCCACGCGGGCCGCGTCGTGTTTCACTGTCATATATTCCGAGGAGCGTGTTATCTATTGAGCTAT
CTTACGCTGTCTCCTCGACAGCTTCGGGCTTGGAGAGCTTGGCGTCGAGCTTGACGAGCATGTCCTCAACCATGCTGTCCAGGTCAAAGTCGTGCTGCCA
GCCCCAATCCCTCCGGGCGATGCTGTCATCCAGCGAGCGCGGCCACGTCTCGGCGATCTGCTGGCGGAAGTCGGGCTTGTAATCGCACTGGAAGCTCGGC
ATGACCTTCTGGATGGACGCCACCATCTCCTCGGGTGTGAAGGACACGGCCGTGATGTTGTACGTGCGCTGCGTCAAGCAGTCGTTGGGTGCGTTGATAA
GCCCCAGCGTGGCCTTGAGGCAGTCGGGCATGTACATCATGGGCAGCTTGGCGTCCGGCTCGAGGAAGCACGTGTATTGCCGTGCTTGAGTGCGTCGTAG
AAGATCTCGACGGCGTAGTCCGTGGTGCCTCCGCCAGGCAGCGCCTCGGACGAGATCACGCCCGGGTACCGCACCGAGCGAAGTCCACGCCAAATTTGTT
GTGGTAGTACTCGCCCAGCAGCTCCACGTGCACCTTGGTGAGTCCGTACATGGTCGTGGGGCGCATGATGGTCGTGTCGGGCGTCTCGTCCTGCGGCGTA
GAAGGCCCGAAGACTGCAATGGTGGAGGGTGCAAATACCCGCAGCTGGTACTGCTTGGCCAGCTCCAGCACGTTCTGGATGCCGCGCGTGTTGACCGCCA
GCGCCAGACTCGGGTTGGCCTCGCCCACGGCCGACAGCAGCGACGCCATGTGCACGATCGTGTCCACGCCCTGCTCCGCCACGATGCGCGCCATCGAGTC
GCGGTCCTGCACGTCGCAGTAGACGAAGCGGCTGTCACGCGGGCCCGAGGGCGCCTTGATGTCCGAATTGACGATGGCGTCGGAGCCGAAGAGCTCGCGC
ATGTAGGGCACGAGCTCCATGCCGATCTGACCCGTGCCGCCCGTCACGAGGACGCGGTTGGCGGCTTGGGAGAAGGCCCGCGTGGATGGACGAACGGCGT
TGC