Description :
From Genome Similarity Track
Location :
Scaffold_514:10489- 12121
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_514-abinit-gene-0.13Ankyrin 2,3/unc44

Sequence
1632 bases(100 bases per row)
GACGATCCGTGTGGACCCCCTGGACGAGCTCGTGTTTGGTTGTGGCGGCGACGAGCGCCTCGATCACTTGAATCGCCTGGGCGGAAGTCGTGAAGAAGCC
CAGGCATGCACAGTGGATCGGCAGTAGTCCAAAGATATCGCGCACGTTTGGATTGGCGCCTTTCTCGAGAAGGAACAGTGCAGCATCGACGTGACCGTGG
AGGAGCGCCAGGTGGAGGGGCGTTTGGCCCATGTGATTGCAGGCGTCCACGTCAGCATGGCGATGCTCGATGAGGTCCGTGACGAGCTGGAGCAGCACTG
ATGGCTCCATGATATAGCGCGACGATCGGTACCGAAAGCAGACATCCACGCCCCGCATGCGTTTGCGGACCACGCATTGCGAGAGCAACGCATGGAGTAC
GAAGTCACCATGAGAGTTCGAGACGTTCACGTCGAGTCCCTTACGGAGCAGCGTCTCCAAGAGCTCCACGTCGGGCGAGCCTTCCTCGGAATCCAACTTG
ATCAGCGTGTCAAGCGGCACGACAAAAGTTGTGTTGACCTGCGAATTGTAGACGCTGGAAATCAAGTGGGAGATATCGCTCCGGACTGGTGCGGCCAGTG
CANNNNNNNNNNGTGACCTGCGAACTGTAGACGCTGGAAATCAAGTGTGAGATATCGCCCCGGACTGGTGCGGCCAGTGCACAACCCCACACAGCGACAT
CCATGCCGTCCTGCGTGATCGCATCGACGCTTGCGCCGGCCTCCAGCAAAGCCAACACCAGTGGATTATTCTTGGTGAGCAGCGCGAGCATTAGTGGCGT
CGTTCCGTCCAGTGAGCTGGCCGCGTCAGGTGCGGCCCGAGCAGCAAGCAGCGCACGCGCGATTTCGTCCTGACCGAGTTCAGTCGCCAGGAGCAGTGCC
GGCACGCGGTTGTAGTCGAAACGGGGCACATCAAAGGCCGTGTCCAGCAGTTGGCTAGCCCACGTCGCGTGGAACTCGAGTTTCTGAGTCTGGAGGCTCG
CGACGTCGATCGTCGGCCCTGCTTCGACTTTCGTCGTCTTGCTGTTGGCAGCCGCAGCGACAGCAGCAGCAGCTGTGAGCTGCTCGTGCAAATCGAGGAG
CTCTTGGCGCTTTGCAAGCGCTTCGTTTTGCTTGAGCATGCCACGCTTGATCAAACAAAGTGCGAGTTCTACGATAGCGTGAGCGGCTTCTTGTCGTTTC
ACATTATCTCTTGGACACTGCGGCACTCGCTCGCTGTCAAGAATCGCGAGGAGATAAACCAAGACGCCGTGGCTCAGTGCGACATTGATGAACCGATCCG
TGTCCGTGATGGGGACGTCCACAGTCGAGATAATCCCACTCGTCATAGGCGGTGGCGCCGTCTTCGAGATCTCGGAGTGACTACTTAATATCGCCGCCAA
CACGGTGACTGCAGCCTCGAGCTGGAAAAAGCACGTCTCGGGCGTCTCCAAGACGCGGACAATTGGCGCGAGAAGCCAGCCGTGCTCCGAGTGGCTCGCC
TCTTCTCGAGTCCATGGCCACACCGAGGGATTTGCCGGTGGAGACAGTGTGGCCGGTTCGTCTCCTTCAACGGGATCAGGCCTGGTCTCCATTGCGGTCT
TGGCCAGCGAAAGCATGGCACGCACGCCGCCT