Description :
From Genome Similarity Track
Location :
Scaffold_23:104861- 106957
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-1.2P-type ATPase (P-ATPase) Superfamily

Sequence
2096 bases(100 bases per row)
TCATGCAGAATTTTGTGCCGATATCCTTGAACGTCTCCTTGGAGTTTGTCAAGTATTGGCAGGCATATTTCATGGAGCAAGACCTAGAAATGTATGATGA
GGCATCCGACACACCTGCAGCTGTGCGTTCTTCAGCTcTtAATGAAGACCTGGGTCGGGTCAACCACATTTTCACCGACAAGACGGGCACGCTGACAaTG
AATTTGATGCTGTTTCGATACTGCATGATCGGTGAGAAGCATTATGGAGGAAAAaTTGAAGACAGTGAGATGGAAGCGACATTTtCCGGtCcTATCGATA
AaGCCAATTtCGTCGAGTTCGATCCTTCCGATATGTTTCTTGATCTCAATGTTGGAGGCTCTCAGGCAGAGCGTATTCGTATGTTCCTCCGtcACCTCGC
TTTGTGTCATACACTTATACCTGCGAAACCTTTTCAAGAAATGTGCTCAGCAAcTACCCcTGAATATTCAGCATCGTCACCAGATGAGCAAGCACTAGTG
TCTGCAGCAGCATTTTGTAACGTTCGTTtCGTTCACCGCACTCCCACTACGATGACAATATTGGAAGCTGGAAGACCGGCTTCGCAGTCAGTGTTCCGAA
TTCTTCAACTCCTTGAGTTCGATAGCGATCGAAAGCGAATGTCGATTATTGTTGAGACACCGGAAGGAGAAATCATGTTATTGTGCAAGGGTGCCGATAA
TGTTATCTTGGAACGACTGGAGGTCTGTGAGGACACTTCTCACATGGTTGACCAAGTGTACAACCAGTTGTCGGTCTATGCAAAGGTCGGCATGCGGACT
CTATGCCTTGCCTACAAGAAAATTGATCGTGAAGTCTATGACGAATGGAATCATCGCTTCTCAACCGCGACCTCGTCTATGGATGAGTTAGTGAAGCGTC
GACAGGGACTTGCAAATGCTATAGATCCTCTCATGAACGAAATCGAGCAGGACCTAGAACTACTCGGGGTCACTGCCGTTCAAGACAAACTTCAAGTTGG
TGTACCAAAGACACTCCAGTTGTTGCAAGAAACCAACATGAAGATTTGGACGTTGACTGGAGACAAGATGGAGACGGCGGTTAACATCGGTTACGCGTGC
AACCTTCTAGCAAATAACATGATTGTCAAGCAGCTGAGTTGTGACGACTACGTGTCGACACTCAAAGCCCTACAAGAGGTTTTGGTGTGGCACTCACAGG
CGAACGCTCTTAGTCGCAAGAAGACAACAAAGCCTTCTCGACTCAAACGCCGAAGTCCGAAACGACCAGCTACACAGAGATCACAGACCTTTCTTGATCA
CGTCCGCGAATGGTTTGGTAGCTCCGATTCATCTTACCGCCAAACGAAaGGTGCAAGGGCACGATTGCGCTCTAAGGGTCGGAGTGGTTCGAAAGCCGGG
TACTACTCTCCGTTTGCTGGTGCTCACGACAGTGATGGTGACATAGATGACGACTATGATGATATGGGTGACATGGCTGAACTGGGTCCTTTGCTCAATT
CAGATTCAACGATGACGAATTTTGTCTCTTCAGCTGGTAAACCCCGTGCGCAGCGGGTTCCTCCACTTGCACTTGTCATCGACGGTACGACTTTGGAATG
TGCATTGCGACCTCGTCTACGCAAGCTTTTCTATGATGTTTCCAAAGTTTGTCGTTCCGTCATTTGTTGCCGTGTGTCTCCGAAGCAAAAGTCTGATGTT
ATTGAGCTCATTCGAGAGCTGGAACCTGATAGTATCACGCTAGCCATTGGCGATGGTGCCAATGATGTCGGGATGATTCAAGCAGCTCACATTGGAGTTG
GTATCTCTGGCCAAGAGGGCACTCAAGCTGTTAATGCGTCCGACTATGCTATCGCTCAATTTCGGTTTCTTCAACGCTTGCTGTTCGTACATGGCCGTTG
GGCGTATCGTCGTGTTGCAAAATTAATGAGCTATATGCTCTACAAGAATGTGACGTACGTCCTTACGACGTTCTGGTTCGGATGTTTCTGTGGCTTCTCC
GGCCAACCGCTCATCATTGACATTGCGGCTCAAAGCTTCAATGTTCTGTACACGAGCATGCCTCTAGTGTTATTCGCTGTGTTTGATCAAGACGTC