Description :
From Genome Similarity Track
Location :
contig_2:1048560- 1050195
Transcript NameFunction/comments
g746.t1hypothetical protein

Sequence
1635 bases(100 bases per row)
GTTGGTTCGTTCTAATTTGCTCACTCGACAATTTCTTCTGGAGGGGAAGTTCGCTGCTGTAAAGGAGCTGGTCGAAGAAAACTTGCCAGAAGACTCCATC
GGCGTGCTTGACATGCATCGTGCCGCGCAATTGCTGCGCGACGACGACGAAATTGAGCAGGCCATGCGCGAGTACCTCTGTTGGCGCGCATACATTCAGG
CGTGCGCACAGTACGATCTGTGGAGAAACTGCATCAACAACCCTGGCGCCGAGGCGCTGTCGCTGTATAGTGAGGAGAAGGACTACCTGGCAGATCTGAT
GTTCCACGTGTCGCGGTCAACTGCAGCCACGCTGGAGGTCCTGCACTTTGAGAACGGGTGGCTCATGGGTTGCTCCAACGATGCAACAGAGGACGCGGCC
ATACGGGAGCGTTGCTTGCCGTCGCTGGTCTTCAATTTGCACTTCATTCAGCTTGAGTCGGCCAAGACAATTATGCGTCTGAACCATTACCCGGAGGACG
CCAAGGCCGAGCTGGCACGACCGCTTCTCGAGAAGTCAATTGAGGTCGCCGATGTCGTGGCCGACGAGCACTACGCAGTGTATAACGCGCTGGACCAGGA
CCAATGCCGTGACCTGCTGCATGGTTTCCGTGAGAGTGCTGTTTCGCTGGCGTTCGTTGAAAGTATGCCAACCCCGACGATTTCTCCCGACTCCGATCAA
GAATAAGCGCGAACAAGCAACTACCTGTGACAATTAGAGAGATGAAATCGACAGTGAGGAAGCAGACTCTATCTCGTGGTTTTGTTGGCTGTGTTGTTTT
TTATCGATGGTTTGTTTGGAAAGTGTTGTGATGACCTGGTTGACTTTGTGCCAGTAGGAATGACGTTGCTCTGGTGGTTACGGGTGAACAGGGGCAGCAG
TCTTGCTGTAAGCTCCCCCAGAACTGATAGCGCCAACAATGTACTCTTCAAACAGAGTTTTCTTGCGGTCTGCGCTGTCGATGTGATCTTCGAGCATTTT
GTGCGGCACTCGCCAAACCTGCGGACATGGCAACCCGGGCTGGTTCCATGTCCACGCGTGTTGGTCACGGCTGTCGCCATTGTTTTTCTTTACCAGCAGC
ACGTTTTGAATCCCAAAGTCTCGAGAAACTGCTTCCAGCCGAACATCGTACGCACCGCTATCAGTCAGAACACGGCCGTCGGGGACAAACGGGGCTGGAC
GGGTTTCAGATATGCCTACCACCCCGGTAAGGTCGGTTAGAACGCTGTTTGTGTAGGCTCCTCTGAGCTGGAGCACGCTGGTCCCCGATGGAGCCATGAA
GAAGCGCACATTCGATTCACGATATTCACCAAACCACGAAGAGCAACGCGTCGTAGTGTGGAAACAAACGCCGTCAATCGTCACGTAGGGGGCAGAGGCA
CTAACGGGGCGGATACTTATGTCGATCTGAACCAGCTTTTCGCCAGTTGCAAGAGGAACGCAGTGCACTTGGTAGGGGCTGCCAATCTCCAGGAAAGTCG
CGTGGAGTTGATTCACTAGCTCGTCGAACATCTGCGCACTCTCGAAAGACTGCACGGACGTCACTGAACCGCCTTGTATGCCAACCAAAATCCCAAGAGG
TGACGCTGGTGGGTATTCTGCAATTTGATTCGAGA