Description :
From Genome Similarity Track
Location :
Scaffold_131:104814- 107261
Transcript NameFunction/comments
g3041.t1hypothetical protein
g3042.t1POM68423.1 Hypothetical protein PHPALM_15418 [Phytophthora palmivora var. palmivora
g3043.t1hypothetical protein

Sequence
2447 bases(100 bases per row)
GGTGATGACGGACACCCGTGGGTGAAACGCGGCAATTTGTTCACACGAGGCCCTGGCGCATACAAAATCCCGAGTGCCAACGATGTGCCTTTGGATTTCC
ACGTATGGCTCGAGTCCAACCAGAAGAACAAGTTTGCTGTTCACTCCAGCAAAGCTGTTGGGGAACCACCGCTGTTCTTGGGCTCCAGTGCATTCTTCGC
CGTCAAGGAGGCGATTTATGCGGCAAGGGCTGACGCTGGTGTACACGGTTACTTTGAGCTGCGTAGCCCCGTGACCCCGGAGCGGGCGCGAATGGCGTGT
GCTGACAAGATGTTGAAGAAAGTGTTTACGGCGCGTGGAGGTGACATGGTTAGTTACCAGCCCAGCGGCAGCTTCTGAAGGGGTGAAGGAAGGAAATACA
TGTGAGCGTACGATTACCATATAATTGACACCCGGCTGCTCTACGCAAACATGCTTGAGGCTCACGGCATCGTACTCATAAATCGTCTTCTCCGAAAGAA
GTTCTTCGACACACTTTGCCAGCTAGATCCCGCACATACCCATAGAGTAGCAGTCTAAGTTGGCGTCAGGTACTCTGTGCACTTGCAGAGACCGCGATCA
TACTCTGCTCCAACGAGGAACTCGACGTCCGGTGTTGACGATGAAATGCGATAAATCTACGTCAAAACATAGCAAGCCATCAGTAAGGTGAGCTCACTCC
ATATCGCAACAGCAACGCACCTTGTGCCTCCCCCACGTGATGGAACCAGTGATCGTAGCGTTGATTCGAAAAATGAGCTCGTTTCTGCTGAAGTCTCGCC
ACAAAGCGATACCTTCAGAATAGCCCGGCTGAATATTAATGCCCGCGATGACATCGCTAATAGCTCCTGCTTCCGCCCCCCACGGTTTGTCAAGCTCCCA
CTTGCCCACAAGGGTCGAGTTATGGTAGATATCAGCGCTCCCAGACTCCAGCACGAACCCAAAGCGATTCTCGTTGATGACACTCACAAGGATTTGGTAC
TCAACCTTGGGTTCGAGACCCATGAGACTGTGGAGGATAGACTCCCATTCAAATTGACGATTGCACACGTTGTAGTCTGGCATGCGAGGGTAGAACATCA
GCGCCAGCACAGTCATGGTGATGAGCGCGGTGAGCCACGTTATCCGCGAGGCAAAAGCGCGCCAGTTAAATTGCCGTTCATCTTGTTCATAGCGAGATCG
CAGCCGTTCGAGCGACGCCTGGTCCACTTCGTTCTCGAAGAGCCTCACTTCCCCCTCCCGGATCTCTTCAAGCAACAGCGGCTGTCTCTGCGCCTGGGCG
CGTTCCTCCTCCTCCCTATTGTGGCAAAATCACCAACAAATGAGCACAAGTAAACGCACTTTAAATGCACCAAATCCCAACCTCAGTGTCGTCTTTTTCT
TCTTTTTGCCCTTCTCCAAAGCAGCCGCGAGCTTCGCCCGACGCGAGGGCGACTTGTTGCCTCGACAGAAGACCGAACAGATGGCCGAGAGGCCGCAGAA
GCAGCAGGTCAGCGTCACCATGAGACACAGCACGGCAATGACCACCGACGGAGGCGGTCCATAGCCCACATACTGCGGATCCTGTCGCTCGCAATCTGCA
CACCAAGAGAGAGCATTAACCCTCAGAATCACGAGAGCATTGCATCTTTCAACAGAGCGCGTGAACCTTCGAGGTGGTGGCACGTGCTCATGCCCACAAT
GCAGCCTTTGCCCACGACGTGGCACTGGAAGTCACTTTCGCAGAAGTGGCACGTGTAGCTCGCGTTCAGACACGAGTCGCAGTCCTTGTGCGACGCACAC
GTGTCCCACTGGACGTCCTCCGCGCCCTGGAAGGCCGCCACCGGCGCCTCATTCGTCTGCATTGCCACCGTCTCCATCGTTTTCTTCGTCTGGCTGGGGC
TTCAACCTGATGGCTCCCTCCCCGTCCAAAGTGATCACATAGTGTCCGCCACATATATTAGAAACTGTCATTTCAATACACATAACATCTTATGGCTACC
ACATACATTCGCAGCTATCATTCTAGTACACCCCAATTCAGCGCGTGGAAGCCGCGTCAGAAGCCAAAAGGCGGAGATAGAGCCTTGTTGCTTGCGTCCC
CCCAGAGCGTAGACAAGATGGCTGCGCGCGAGCCCAAGGAGAGTCGTGCCGACTGGGTGGCGGTGGAGGCGCAGTTCCAGAACGGCGAGAGCAGCGCCTC
CCAGCCCGCCAAGGCTAGGAGCGCCTACCAGTTTTTCCAGAAAAGTGCCATGGACGTCGTGAAGCGCGACGTGGCGGCCAGGGCGGCGGAGACGGGCGAG
CCCATGGAGCTGGGCAGCATTTCCAAGGAGATGAGTGCACGCTGGGCACAGCTCTCAGCCGGAGAGCGCGAGGAGTTCGTGGAGCTCGCGGTCGCCGACA
AGAAGCGCTACGACGACGAGTGCCGTGCCAGGGACGAGGAGGTGGAG