Description :
From Genome Similarity Track
Location :
Scaffold_78:104813- 106017
Transcript NameFunction/comments
Physo_139756hypothetical protein

Sequence
1204 bases(100 bases per row)
GCGTTGCTCAGCATTTCCAAGAGTACAGTCACCAAGAATTGGCAACTCGTCGGTCAGCATTCCCTGGAGCTTTGTCACGACTTCGAGGTCATTAAGAGGG
TCAAAGCACGGAATCCTTTGCTGGATATAGTCCTCCTCCTCGGTGTTTTGATGGAGAAGAGTCCGAATTACGCTCATCGTGGCTGCGTACTTTGGGGTTC
CTGTTGTTGCAGTGAGGAAACAGTCGTTCAAGGCGTCGATCAATAGCGATACAGTTGAAGAATTGTTCGAGTCCTCGATAACTCGCGGAGGTCCTCGGTA
TCTCCCATTCTGAACAGCAAACACTTTCGAGTATTCGCACGCCTGGACGTTCGCGTGGCAGCGGGTGCAGACGACGATCGCTGCGATTCGACCGGTGGCG
CTCTCCATGTGCTCCGCCGTCCAGCAATTGGCGCAGACGAAGTATCCACACAGATAGCAGCGTCTTGTGGCGATCTTCACGTGGGACAAACTCCGAGTCG
CGATGGCTGAAGCTGCGATTGACAGTGAGAGCTTGAAGGGTGCTAAACTGTGCGTACAACACGGACAGCGCGTGTTCTGGGCTCGAATCGCGCTCAGATC
CGCGGGGACTTGGACTCCAAAGCGTCGACGCCGCACGATATTCGGGAGCTGAGTTATCCCTCGAGCCATGGCTAGCAGCCGACGCAGTTGAACTTTGTAC
TTCCGAGTATCTCCACAACTCGTCGATGATCTTGAGCCTGAACTGGAGCTGGAGCTATTGCTTCGACTACCACGAGACTGATCTCCTTCGTTTTGGGGCG
GCTCAAACCACGCGCGGAACACTCCTTTCGATCTGCGGGTTTATCCACGAGGTACGAAGTGTTTAATCCGTGAAGCTGCTCGACGTGAGCGGGTTTCTCG
GTAATTCGTCCAGGAATGGGCTCAGAAGCTGGTAAAGCGCGCTTTGTGATCGTGAATCCGTCGCGCTCGGTCTTGCGACGAAAGTAGTCGAAGTAGCACC
ACTGCTCATTGCGCCCCAGCACGGACGTGCGCGCGAAACTCTTGGTTTTGACTACGAGGTGCTCGCTACCGTCGACATCTCCGTCGTCTTGGGTTTGGTT
GCTGGCGCATGAAATTTCCCGTTCGTACGACCCGAAGATGAAGCTCTTGGAGTACAAAGCCGACATCGCACAGTTGAGCTCGCCTTCCAAGTTGGACCGA
AGAA