Description :
From Genome Similarity Track
Location :
Scaffold_6:1048013- 1052133
Sequence
4120 bases(100 bases per row)
ATCGAGACGTTGGTGCTGATGATCAGGTCCATTACCACGAGGGCGGGAATCTGTCAGCAGAAGATGTCGAAGGTGAATTAGCTGTGCTTCCTGAAATTGT
AATCTCGACGACGGATGAGGTGAAGATCGATGATATCAAGGTGGGAGATCTGGAGTTCAACACCCCGGAGGAGATCGATCGGCTGTGAAAGAAGATCTGG
CACAGGAATCACCTGCTGATCGGCAAGGGCAATGCACTTCCCCCAGCAGCCCGGGGCGACGTGGGCGACGCGAAGCCGATCGCTCAACGTGTCCGGAAAG
TTGCCCCTCAGTTCGTGGAGAAGGTGTCCGAGCTGATCAAGGGATTATTGTCAGGCAAGATGATTCGGAAATCTCGATCACCGTGGGCCTCGCCGATCGT
CGTGATCATCAAGAAGAACGGCGTGGATATCCGACTCTGCATCGATTATCGGCTCGTCAACAGTCTAACCAGGCTGAAGGTATATCCGATGCCCTTGATC
AACGATTTGCTGGAGGATCTGGATAAGGTACTCTGGTATTGCTCTTTGGACATGGCTAGTGGATTCTGGGTGGTGACAATGACCGATCGAGCTCGTGCGA
TCTCGGTTTTTATCACCCACATGGGTCTGTTCGAGTGGAACCGGATGCCGTTCGGCTTGAAGAACGCTCCTCAGATCTACCAGCGACTTCTGGACGACGC
GTTGTATGGGTTCACCAGGATCCCGCGATCGTCAGACTGTGAAGTCACTACGGACTTGATCGAGTCAGATGAACCAGAAGATCCGGGGCGTCCATCAGTG
CTAGGTCGCAGATCGTACATCGATGACATTGTTGTGACGGCCGGATCATGGGATGAGCTGTGCGATCGTGTGGATCACCTGCTGGACGCTTGTGATAAGT
GGAATCTCTCGATCAGTGTGGAGAAGAGCTCTTGGGGGATGCGTAAGGTGGACTATCTGGGACATCGTGTGTCGAACGACGGGCTAGAGGCCAATCCGAA
GGATCTCACTGCGCTGACTGATCTGCCGTTCCCCGGATCGCTCCGATCGATGCAGTCATTCTTGGGCAGTCTCAACTACTACAGTTGTTTCTTGGAAGAT
TACGCGATCTACGCGGCGATCCTGTATGAACTGCGCGAGGTGGACTTCGCCGAGCTGAAGAAGCGCCCTGATCTGCGCCAGATCCTGGATCGTCAAGTGC
CGAACTCAGTGGATACGGACCCAGTGAATCCCGATCGGACTCCACCAGTTCCTGAAGTCGGGGTCGCCGATGAACGCTGGATCCGTGCTCATCGTGCCTT
TTCGACACTGAAGATGAAGATCGCGACGACACCGATCCTGCGGCACTTCGATCGCGATCGGACTCCGGTCGTGATTGTGTATGCGAGTGACTGGGCGATC
TCGGCCGCATTGACGCAGGAGCACGACCAGATCTATCATCCCGTTACCTTCGCCAGTCGAACGCTGAAGTCAAATGAATTGAACTACAACGTGGTGGAGA
AAGAAGTGCTGGCGCTGTTACGGATCCTGGACCTGAACTATAACATGCTGGTTGGACGATCGATACGGGTCTTGACCCGACACTCGACGTTGGCGTGGCT
GTTCCGATCACCCGGCCTTCAAGGCCGATTGGGTCAGTGGGCTGCACTCCTATCGCCCTGGACACTGGAGATCACGAAGTGCACCAAGGGAGAGGACGAG
ATATTGGGGGCGATCGCCGCTAGTATTACGCCTCGATCGGATATGGACGACGCGTTGATCGCGATCGCGCCGAAGAAAGAACCCCGGCGGAAGATTCATG
CCCCGATCCCGACTGTGCGTGCGAACGGAGAGCTGCTGGTGATAAGTTTCGATGGATCTGCCCGCGTCAAGCGAGGCGGAGGCGCATACAGCGCGATCTT
GTGGAAGTTACCCGAATGGAGTGTGGTGAAGGCCCGAGCGGACTATGCTGAAGGGCTGACTGTAAACGAGGCAGAGTATCATGGTCTGTTGTTGGGTTTC
GACCTCCTTGACGGCATAGATCAAGGCAGGATAGTGGTCTGCGGTGATTCCAACCTGGTGATCCGACAAGTACGGGGCGAGATCGACTGCAAAGCACCTA
AGCTGACATTGTTGAAGCAAAAGGTGCTGGATCGACTACGGAACTGGCCAGATCACGAGCTGTTACATGTGAAACGAGACTGGAACGGAAGTGCGGACAG
CCTGGCCAGTGCAGCATTCCATCGTGAAGGGGGCGTCGTCGTCGAGGAGGATGCCGATCATAGGGATCTAGTGACAATGAACCGACTTGATGAGATCCTG
GTCGCCCGGTCGGATGAGTCGATCGCCTGACTATCGCCGATGACGACCCGATCGGGCACCAGATCATGGCCGAACCCGACCGTCATGCAGGAGGAGTTCG
TGCGAGGGTTGCGGATCGATCGGATTCGTCGAGCACAGGATGAAGAAATGTGGATCGCGGGTATGAAGAAGTATCTGATGGGAGATGTGGCTGATCTGAC
ACAGGATGAGGCTCGATCCTATGGCAACCTCGTAGCGGACTACGAGATCGACGGTGATAATCTGCTGTTCTATTGCCCACTCTCCAAGCGATCGGAGGCA
GATCGAGATGGACTGCTGAGACTGGTCGCACCGGAGACGCTGCATCAAGACATCCTGCATCAATATCACTCCACTCTGGAAGGTGGACACCAGGGGATCG
GGCGTACATACCAGCGGATCCGCGATCACTTTCACTGGAGAGGTCTCTTCAGAAGTGTGCAGAAGTACGTCGGCGAATGTGTCGACTGCGAGACCGGCAA
AGGACGACCCACGATCAGGGGGAGTCGCCGGGAAACATCCAGGCGACATACCCGTTCCAGATCATAGCAATGGATCACATACCTTCGCTACCCAAGTCGT
ACAAGGGTAATACGGAACTGTTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGCTAAGGCCAGTTCCTCCCGAACGGCGCAGACGATCGCCGAATC
TTACGAAGAGTGCGTGTTCCGGCGATTTGGTGCTAGCGAGGTGATCAGGCAACGATCGAGAGCCGGGATTTATGGCTGACGTCTTCCGCGCCTTTAACAA
GATCCTGGGTATGCGCCAGCGAGCGACCATGGCATATCGACCTCAGGCTAACGGTACTGCAGAGCAAATGGTACAGACTGCGACGAGAGCCCTGAAGATG
TTCGTGGAGGATCTGGATCAGAGGGATTGGGATGAGTACGCAGAGCGATTGACATTCGCGATCAACACGGCTCAAGATCGGGTCCGTGGGGACTCCCCTT
TTTATCTGGTGCATGGTTGGGATCCTCGATCGACGCTCGAAGCGACGATACCTTGGGGTAGTACTCGGACTCGGGATCGGAATCCTCGACGGTGGCGTTA
TCGGATCCAGAGGCACTACGATCAGGCTCGAAGTCAGGTGAATGCTCGCCTGCGCGAGGCGATCGCGGATCGGGCCGATCGACACAATGAAGAAGTTCGA
CCACACTCGATCGAGGCTGGATCTCAGGTGTGGCTGTACCTGGATCGTGTGAAAGAGGGGTATGCCCGGAAGCTAGCTCACCTGTGGCACGGCCCGTTCC
GTGTTGCGGAGAAGGTGAACGAGTACACGATGAAGCTCCAGATCGCCGGTACGGACTATCACCTGTTCCCGATCGTGCATGTTTTGAAGCTGAAGTTGGT
CAAGGACTTCCCCGATCGACCACAGATCGCGCTCACGGTGGACGAAGCAGATCGACTTGATTTCGACGAAGTCTTACTTCCGGAGGACAGCTGGGCCCCA
GATCGAGACTCGAACGAGTACGAAGTGGAGAAGATCACGGATATGCGGACGGGCCGAAGGACGCGATACGGCCGGACTTATCGAGAGTTCCTGGTACATT
GGAAGGGTTACGACGAGCCTGGCTGGGTCGACGAAGCTGATCTCAACTGTGAAGCTTTGTTGCACCAGTTCCTTCGAGATTGCGTGAACCGGAACCGATT
TGGCGCGATGCAGTCTCACGAAGAAGAGTGAGATCGGACCGCCAGGGCGAGCTGGTCGCCTTGGTGAGCGAGGTGAGTGACGGATCGACGGGGAGGCCGT
TGATCGGAGGAAGGGGTTTT