Description :
From Genome Similarity Track
Location :
Scaffold_162:10480- 11831
Sequence
1351 bases(100 bases per row)
TACGCGTTTCAACCAAACTGAAATCTAAACTTCAGTGCCTAACTTCATGTCCTCACTACGCTCCGCCAAGGCACACGCCTTGACCgcatgacgctcgagc
caccaaacgagtcgccgggtgtttgttggcaccgcctgcgccactgcctccttcattatgaccaaccggtacTCTGCGTACGTGTCATACACACACCGAA
CCATAATTTTTGGTTCTTCGTAGCCATGAAGCGCAGCATCATGGACTTGAGCACATTCCAACACCCCTCGATGGGGTTCAGCATGGGGCTGTACGGGCCC
CGCCGCAGCAGTACGAGCCTGTTCTCGTTCATGATGCCGCCTACCACCAGGAACTACCAAGCCAGATCTTTGACCTGACTATGGGCGGGCGCATTATCTG
TCACGATGACGACCTTGTTGCTCGGGGACAGGTCCTGACACTCCAATGATCGCTGAGCCGCGACGAACAAGTCAGCGATGAACCGCGCCATTTCCGTCTT
AGTGATAGAACCCTCGTGCGTACGAGCCCTGTAAAGGCAGAGACGCTACCTTGAAAATGCAAGTTCTTACCTTGCAATGGGGGCAACGGCACGACGGGGC
GCTCGCCCACGCGAGACCACCGCTTCGAACAGGACAAGCACATATTGAAGTTGGTTTCGTCTACCTTCTCCACGAACTCCTTTCGCTTCCGCTTGGTGAT
TGTATTGTTCGTTGTAGCCTTCTCGACGCGTAGCGTACGGCAAGCCTTATAATGCACGATGAATCGAGGACTTGCTCACAGAAACCCCTGTATCGCTCAG
CAGCTTGTCGCACATGTCAGTTAAAGTAGCGCGGCAATCCTCGTCTAAATACTCTTCCAATTTAGCCATGACGTCAACGGTCATTTTAACGCACGACGAG
CGCACGCCCCCTCTTTGCTTCAGGTCCGTGCCGCTATCGACCACGGCACGGCGAGCAGTAGTGTAGGGTAGGTCGTTATGGATAGCAGCGAGTTTCCGGT
CTCCCCCTTCGCGGAAGACTCGGAGAACTCGCTGCTTGGCGAGCTCACGCGCGTGGTCGTCGACGTTCTTGGGGGACGGGTGGGAAGGCATTATGTTGCC
GCTCTGCAAAATACAGATTGAAGGGAGTTGGGGCACAGTTCTGAACAGCGTGGCAGCTCACCAACCACTGGCGTGTGGTTGTTTTGGCGCCAAAAATTGG
CGCCTTTCACTTTGCTTGGAACGAGTGATGGGCAAAGTTTGCTCCGCTGGGAAATGTCTTCTTTTGTATCGACTTGTAGTCTTTTTTTCGTAGGCACATC
CCCCtttcactttggttgaaaaaaattgcaagtagcttgggaaatgatgta