Description :
From Genome Similarity Track
Location :
Scaffold_993:1048- 2557
Transcript NameFunction/comments
Phypl_g11962transposase
Phypl_g11963hypothetical protein

Sequence
1509 bases(100 bases per row)
CGGCTCCGTGCGCATGGAAGAGAACGCAAGGTTCGTGGCCGCCCTGATcacggacgagtacaagGAGTGCTGCGTGGGCATGAAGGTTGTCATTGTTACT
GACAACGCCCCCGCCCACAGCCAGGTGGAGACACTGGTGcgtgagcagcttgttgccgACGGTATtgtcaacagcagcaagctaGTCATCTTGCGCCTAG
CGCCGTACAGCCCGATGTGCAATGCAATCGGGGTTGCTTCAGCGCGCTGAAGAGCATATGAAGACCCACCTAGCTACTGAACGGCACGAATTTCTTGTCC
GTGGCGCCTACGATTATCTGACCGCGCAAAGGATCTCACTGTTGAAGgaagcggtggagctggacaagcagGTTCTTACGCAGCGTTTGGTCTGGCGCAT
GGAGCGACACTGCTTCAAGAGCATCTTCAGTGCGGAGCGTGGCGAGGACACGGAGCTAGGTAAGTAGCTTTCATAGAAACCACTTTGCTTGGTAAAAAGA
TATCAGAAAACCGTTTTGGCTGGTAACTGTACTTTTATGTAGAAATATTAAGTTGCACGAGTGCGCCAATACCGCTTTGCCTGGGAAAACGACCATTCTG
CTTGAAAAAAGGTGTGCACTGCCCTTCATGACGGCCATGGTCATGTCCGCCTGCTCGTCCAAGTACTCGTTGAGCTTAGACATGACCTTGACCGTCATCG
TCACGCACGAGGGCCGCACGCCACCTCGCGGCAGCTGCTCAATACTGACCTTCGCGAGAATGCGACGGGCAGTAGTGACGGACACAACATTGCTGACAGC
GACTCCGAGCCAGTCTCGCCCGGCCAAGTACGCGTCGAGCACGCACTTCTTCGCGCTGGTGCGCTTGTACTGCTTGGCCTCGCGTGAGATGAGGGGCGGC
GTATGCGGAATCGACGTCGAGGGCGCGGGCTGCGGGGTCATTGCGGGGGGCGGAGGGCTGCGGGTGTGGTGGAAGGGAGCTGATGCCAAATGAGAGAAGG
CTAGCGCGGCGGTGTGGGGCATTGATGCCGGAGCTGAGTGGCTGGCGTTGTTTTCCGCCCCTGAACCACTTTGGCTGGGAAGAATATGGCGCCAAGCCAC
TTTGCTTGTAAAACCTTATTTTAGGTTTTCCCGATAAACCTCGAAAGATCGTTTTGCTTGTGAACAAGGTCAGTCTTCTTTGTCTTGGTAAAAAGTGTAC
AATGATAAactgcgctgctgctagaAACAGAAAATTATCAACTAATGCCGAGAAGTGCTGGATTTTTTTCTTGCTTCGCGGATTTTCCGCAATTGATAGT
GTGCGGCACCTCTGGTGGGTCTGAGTGAAATCGTGATACATGTAGAAGAAGTATTTGGCAAAAGTGACGCTTGTGCTCGCAGACTAATACCTCGAAGTAC
ATGTCGGGCTCCCTCTCAGTATGACCGCCTCGTCTCTTGAATACCCCTTGATATATGTTCATGAGTTTCAAGAACAGCTACATCGATTGACGGCAAAGTT
CTCTGCCTA