Description :
From Genome Similarity Track
Location :
Scaffold_9:104771- 107059
Sequence
2288 bases(100 bases per row)
TGATCGAGTTCAAGGACGTGCTCCCTGAATCCGTACCATGCAAATTGCCTAAGGATAAAGGCACTCGACATTAAATCGACTCAAACCGGGCTCGAAGTAC
TGTGTCATGAAATAGTGGCCACTGCCTCGTGAACAAGTACTTGCGATCGACGAGTTCTTTGCCGATCGCTCAGATGCGGGTCATGAGAGGGAGTCAACTT
CCCCTCACAGCTCTACAACCTTCTGTGTGCGCAAGGCTACAGGATGGTGGCAGATAGTGCACGCAATCAACAAGTTGAATGATGCAACGGTACCGGCTCG
GACGCCGATACCGAGGAAGGGCCTAATCATTGATGGTATGTCAAAGAGTACCATCTTTTCTTCCATGGATCTGATGGATGGCTTCTTTCAGATCCTAATA
CGTGAACGGGACATCCCGTACACGGCAGTAAGCACCCCGAGCGGCATGCTTTGGGAGTGTCTAGTAATGCCACAAGGGATTAGTAACGCCCCTGCCACAT
TCAACAGATGTATTACAAATCTATTGAGACCGGTGTGAGACTTCGCACCGAATTACTTCGACAATGTATTCGTCCATATCCAGGCTATGGGCGGAAAGAT
GGACGCAGAGGTTCATAGAACACATGTTCGTCAGGTCGTTACACTTATGCGCAAGCATAAGTTGTATGCCAACCTCAAGACGTGTATATTCACTGCTAGC
GAAATACCACTTCTTCGGTGTATCGCGGGTAAACACAGCGTACGCCCTGATCCTGAAAATATCAAGGCGATTACCGACTGTCCTGTGCCAGTCGAAGTTA
AGAGACTAAGAAAGTTCCTTGGGTATAGCAGCGTACTTACACAAGTACTCGCGCAACTACGCTGAAATGACTGTTCATCTCTTTCGTCTCTTGAAAAGAA
CGAGAAATGGTCATGGAACGCTGATTGTCAGCGTTCCTTTGAAGGTATCAAGCAGAGCTTGATGCAATCGCCATCTTGGCGATTGTAGACCAAGACAGAC
CATTCCATGTGGTCTGTGACGCCGGCGATTCCGCAATCGGCTGCACGTTAATGCAGTACGATGCAGACGACGCAGAGCGCGTCTTCTATTATTAATCGCG
TCAGCTGCAAGCAGCTGAGCGTAATTGTCCAGTGCACGACAAGGAACGCCTTGCCATGAAGCATGAACCAGCGAAGTTTTGCGTCTATATCCTTGGAGAT
AAGCCGTTTGTAGTCTATACGGACCACACGTCATTACGCACGGCCGTAAACAGCCCACACCTCTCGCAAAGGATGGTGAGGTGGCTGTCTTTCTTTGCAG
AGTACAACTTCTCCGTGGAGTACAAACCCACACAACTTCATGTCGTCGTGGACACGTTGTCGCGCCGACCCGATTTCGAGTCTGCTGCGCAGTACAACAG
TAGGGTTGATACCACTGTTGCAACACTAGTCACTAGTGTTCCGTCGTCAACATTGCTTGACGACATAAAAAGGCCTACGCACAAGATAAGGCTCTTATGC
GACTAATGGATCATCTGGTGACTCCATCTCGTAAATCTCTCAAAGATTTACCAACCTTGTATTAATCTTCCGCGGATCAATACACAACGTGCAACGGGTT
GCTGTATTATACAGCCGTTACCGGCGACACACCTCGTGTCGTCGTCCCCACTCATAATGATTTGCTCTTACGCAGCATTTATGAGTGTCACGATGCACCG
ACTAGTGGGCATCGTGGGCGTGAGAAGACTTATCTCACGGTAAGTCGCGAATTTAACTGGCTCTGCCAGTATCAATTTGTGCGCAAGTAAATTCGTGCTT
GTGAATTGTGCCAACGGGTGAAGCTCAGTCCTTCCTCCCGTGCCCCACTACAGCCTCTACCAATCCCGACTGAGTGCCGGCAGTCCGTTTCAATGGAATT
CACTTCAGTCATGACCGATTCAGCAAGATGGTACATCTTGCTGCAGTTCATGAGTCAATCTCAGCACATAGTTGTACCCGTGTTCTATTGACACGGTATT
CCAACTCCACGTTCTACCCCGTGAGCTAGTCTCTGATAGAGATCATCGGTTCACGGTGACGTTTTGGCAATCCGTGTTTCGATCCCTTGGAACACGTCTG
ACTATGTCTACTTCTGACCATCCCGAGACTGATGGTCAGACAGAACGCGTCAACCGCGTCCTCGAAGAGATACTTCGAGGATACGTCCACTCTTTCACAG
ATCGGAGCGAATGTTTGCCGATGGTGGAGTTTGCAATCAACAACTCCGTGCATGCTTCGACCGCGCATACACCATACTTCGTGGATGG