Description :
From Genome Similarity Track
Location :
Scaffold_5:10476- 13142
Transcript NameFunction/comments
Physo_128506putative polyprotein

Sequence
2666 bases(100 bases per row)
CGAAGAGACGAAAGGAGAAGCCGGTACGATCCTCGCCCAGGCTCAGAGAAATAAAGGCGAACTCGGCCCAGACCCAGGCCGACCGGGAAAGAAGGGGTGT
TGTGGTTCTGAGCCGGAACCAAAGAGAGGAAGTGGAGGCTATTGTGTGTGGTGTTGGGTTCATTAAGGAAAACCCGGGGCATTTCGGGCTGTGGACACGT
GCGGACTGGGACTCGCCAAGTGGGGAGCGAGTTTCGTCTGGGAACACCTCCGGAGACCTTCAACATCTACAGCAGCTGGTGTGGCCGACGCGAGTCTGGG
CCCACAGCGTAGCCGTGATCGAACGAACCGCCAAGGGGATCGCAGAGTGAGGAACACACGCCTCGCCCGCCCGAGTCGGAGCTGAGCCAAGCGTTCAAGC
AGCTAAGCCTAGCGAAGCGGAGTGGGAGTGTTCGCTCAGCGGAAGGAGCTGAGCGGAACTCTCGCAGCGCTAAGCAGGGCTGAGCCAAGTGGTGCAAGGG
CTGAGCGAAGACCAAGGTCGAGCGGTCTAGCTACCTGAGCCTTCAAAAAGCACGGGCGCTTCGTCACACCAGCTTCACCGACCTGGACACCTTCACCTTG
TTCGACTCCAAGTCGTACACTCGGTAGCCTTTTGAGTCGTCGGCGTACCCAAGAAACATACATTTGAAGCTTTTCGGCTCCAACTTGGTGCGTCGCGACT
TGTCGACATGAGCCTAACCCATAGACCCGAAGACTCGAAGATGATCCAGCCGAGGCTTCGACTTGAACGTCAACTCGTACGGAGTCTTGGCCGGGTGTAT
GCTGTTCGTCGACCGGTTGATCAGATAGACAGCAGTGCTGACAGCCTCTGACCACCATATCGAAGCCTCGCCCTAGTAGTGCAGCATGCTTCGAGCCTTC
TCCATGATCGTGCGGTTCATCCGCTCCGCCACGCCATCCTGCTGGGGGCTATACGGGACCGTCTTCTGATGCATAATACCGTTCACCCGGCAGATCTCAG
TCATCGGCATGTTCACGAACTCAGTGCCATTGTCCGAGCGCAGGCACTTAATGCGCTGTCCCCACTGGTTCTCGTACAGCTTCATGAACGACTTGAACTT
GGTCACGACCTCGCTCTTCTTGGTCAGGAAGTACACCACGACGTGTCGCGAGTAGTAGTCGACAAAGGTGAGCACATACCTCGCTCCGCCCTTGGACTTC
GTCTTCGTAGGACCCATCGCGTCCGTATGAACCAGTTCCAGCGGTCGAGTCGTCGCTGACGTCGACCGCGACGGGAAATGTGCGACCGTCTGCTTGCCCT
TCATGAATCCGCCGCAAGGGGTCTTCGTCTGCTGTTGAGTCGTCGGGAGCCCGTCTCCGTTCAAGTGTCCCATTCGAGCATGCCATAGCTCCCACTTTCC
GTCGACTCCCAAGTACTCGGTGTAGTACGCCATGTCCTGCTGGCAGTCCAGCAAGTACGCCTTGCCGACCTTCTTCCCCGAAGCGATCGCCTTCGTCTTG
TCCCAGATGACGCACGACTTCCGCTGGAACTCGACACTCATGCCGTGTTCAGCCAACCTCCCAACCGAGAGTAGTCGCCGGTCGAGTCCGGGGATGTGGA
GCACCTCCACCATCTTGATGCGCTTGCCGTCGATGCCCGTTAGGCGCACCGACCCTTTCCCAGCCACGCGGATCTTCTTCCCGTCCGCGATTGTCACATA
CATGTCCGCCGACGACTCGTTGTACTCGAACAAATCATCGCGGTGAGACGTCATGTGAGCCGTCGCCCCACTATCGATCAGCCAACCCGCTGATGGATTC
TCCGCCACAGCAAACACCGATTCTTCGGCGGTGTCTCCATTTGCCTTTTCCAGGCAGTCCCGCTTCATGTGGCCCACTTCGTCACAGTTGAAGCACTTGC
TCTTGAAGCCACCGCACTCCAAGACTGCGGAGTGTACGATTTTGTTTTTGGGCCAATGGCGAGGTACGATCCGTAGCGTAGCAAGGCAAGTGGACACGCC
GAGTACATCGGAAGCCTAATCACGCCGAGTACAACGGGATGTTCTCACACTCACTGTTGTCATTCTTTATCGTGTACATGTAACGGATAGCGCCAAATTG
CGTACCCTCCCCGAATTAAATACCAAGTTGAACGTTGGGTACATAAAAATTTCTTAGAACTTCAAATTTTATGTTAAGTTTAGCATGTTAACATCTTCTG
ATTGGCTAAGGGATGTCTTGAAATGGAAAATCACATTTTATTTTACATGTATGGATTACTTTGTCAAATACGGCAAGCAAGATCCGGTTGTTTTATCTTT
AAAGTGATACTTGTCTTTGGCACGGTTTGCCATTTTTGGAACTTTACGCAAAATTACCGTAAGGTACCCAAAGAAAAAAATGGGTGATCTAAGTTCTGCT
TGCATCTAACGGCATGACAGGCGTTGTGAACCAACTCTGCGCAACCTATGGGTGTATCCACGGTTTGAAGACTGGTACATGCAATGTACGACGTCTCAGA
GGGGCTTTGCAGAACGTAGCTAGCTCCCTACAAAATATCCAGGCTTGTATCGTCGGAGCTACTTTGATAGTATACCCCCCTCCAATTTGTATATCTTTCA
CAAGTGTTCAATTCAATAGTATGCAGTATACAGAACTCTGCCAGGTCTATAAAGTGATCTCAGCGT