Description :
From Genome Similarity Track
Location :
Scaffold_112:104744- 107242
Transcript NameFunction/comments
Phyci_285314Casein kinase II beta chain 1 isoform 1
Phyci_96076Hypothetical protein

Sequence
2498 bases(100 bases per row)
GCCAGTGTAGTACTCGCTGGAGCTGTGGATCTTGTAGCCGAACACGCGCGGTACGTATGTCTGCGTCGGGGGCGGCACCACAAGATGGGAATGCGTCATA
AGGAACACATGCGGGAACGTCGCGCCGAAGTACGCGCCGTCGATTTCTACCAAACAGGAGAAGCATAACAGCAACAAACACCAAAAGTCAGCCGTCAAAT
ATTCTCAACCAGGTCAAGCCACCAACTGTCGGACGTACGTCCCGCTCGCTGCGACTTGGGGAAGAAGATGTCGCGGCACTTGGGGCAGAAGACGTTGACC
GTCGTGTGCCGTGGCACGTCCGACTGGCCCACGGGGAGCACCGGCTGGCCCTGGCAGTAGACGCGATGGCAGCGGCCGAAGTCGACGTTCTGGTACTTGT
CGAGCATGGCGGCCATGCCCTTGGTGGTCAGGATGTAGCGCGCGTGGATGAGCCCGTAGAGCATCTCTGCGGCGGACTCGATCATCTCCTGCTGGATCTG
CGTGAGGTTGCTGTCGTTGGGCGTCTCGATGTCCAGGATGATGTCCAGCGCGTAGTCGTAGTACGGCACGATGCTGCTGAGCCCCGTGAGGTTGAAGTCG
TCCTCGATGTAATCCTCGTCCACCTCGCACAGGAACGAGTTCTCGCGCAGCGAGCAGAACCACGCGATCCAGCTGGTCTCCTCCTCGTCGCTGCCCTCCA
CAtcgttgtcctcgtcgtcgtcgtcatcgtcgtcgtcCAGGGCGCTCGAGtcttcctcctcttcttcctcttcctcttcctcgtcctccGAGACGCTGGC
GGCCGCACGCGCCGCCTCAGACACGCGCAGGCTCTCCATGTGGCCGAAGAGCCGCTCCATTTCCGCCTCCTCCGCCGTCTGGCCGCCGTTCTGCGCGGGC
TGGCTCATGGCTGAGGCTTTACTTGGCTTGCGGCTGCGATTGCGCGGCCTCTGGGCGGGCTCGCGGGCTCAAAGGCACGGCGTTGCGCTCGGCAGCGTCT
GCGGATTCCGCTCCTAGCGACGGGGTGGCGCGTCGGGCGCTGCGCGGCGAGAGAACGAGGGCCGCTCTAGTCGCACGGGCTCGAGCCTTTAACGGTGACA
GCCGTCGCTTTCCCGAGATAGAGCCAAGCCGCTGGCTTTGCCTGTGCCGGCCAAACCCCGTCAAAGACGATATGATGTATGTGGTACATCAAATGTAGCC
ATTTCGGGGTGAAGCGAGCTGGTGATGGCGGCGGCGGACCGCGGCTGGTACGAGGCCTACGCGTCTGGGGAGGAAGTAGGGCGCGAGCTACaggacggag
aggacgaggacgaggacgagtatgaagaggaggaggtggatattgaggagatggcggacgatgagCCCATGCACATCACGGGGCGGGTCTTTCTAGGCTC
CATCGACGCGGCCAGGAACGTTGAAGCGCTGAAGCGACAGCGCATTGGCGCAGCGCTTGCGTTGCTCGGCAAAGGAGAAGAAGCTGAGGCGGTGTCGAGT
CATCCCAGCTCTGTGCGTGACCAGTACGAGGAGCTGCAGATCACGAGGAAGAGCTTCGAGATCGAGGACTCGGAGGACGCAGATCTGCTGTGCAGGCTGC
CGGAGATAGTGGCCGCACTCCGAAAACTACTGTAAGAGGCCGGGATGGACGTTGATGATTTTGCTGGAGGGTTTGAAGATATACGGACTGACGTTAGCGG
TGATACGGTGTGGGATGGCATCAGTGAGAGGGCAGAGCAGGATGGCACGAACGTGTTGGTGCATTGGTACGGAAGGGCGGATGGGCACTGGTGTGATTTA
TCCAGCTAAAACTGAGGGCTTTGGGCTGTTGGTGTTGTGTTCTCTAGTATCGCCGGAAGATCGCGTTCCGCCTCTGTAGTGGCCGCATGGATGCTTATCA
ACAAGCCAAAACTATTGACCGTGCAAGATGCTGTTGACCGGATCAGGTACAAATTGCGTTGAACCTTTTCGCTACTCCAGCATTTACGATTGTTAGCACT
CCGAGTTCGCTAACTGTATGCGTGTAGGATCATCCGCCCGTGGATCGAGATCAACTCCCACTTCATGCGGGACTTACATACCTTCCACACAGTGCTGACC
TCATCTGATAAGACGCCACTGGGTGCTGACAATGCTGCACTGCTCAAAAGTCGGTCATTCCCGCGGCTGGACTTCGGTGCAAACCTCGTCGACGGGATTC
TCCGGGGCACGAAGGCCATCACGATGCGCCTCCTGTCCGACATTGAGGGCGATCGAAAGTCCGACTTAAGGGACATATTCCCACACTCGATCGTCGCAGC
GACGACCTCAAGCACGGAAGGCTCCTTTTCAAGACCGCAGTTCGCGTACCTGCGGATTGATCAAGTTGAAACACTCGCGTTAAACGCCATCGACCACGCC
ACGCTGCGCAAAACGGGCTTCAACTCAGCCGACGAGGTGCTGACAGTTCTCAAGCAGTTCTACCCCGACGTGTCGGCCACCACGCCGTTGCTCATGCT