Description :
From Genome Similarity Track
Location :
Scaffold_90:104727- 107442
Sequence
2715 bases(100 bases per row)
CGCTTGGATCCACCTCACTGTAATGGTACACTCGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTCGCAACCGTCTGTGATCTCCGTTGTCCCA
CGAAAGTTCGAGATCCACTGTATCCCTCATCCCTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATACGAACTCAGAAGTATGGG
ATCCGGGGTACCTCACGGTGGATCTTGATTCTTCATTAGCCGTGGCTACTAGATCCACCGTCAGAGGGCACCGACCATCCTTCCTTCATAGGATCCACAC
TCGATCCACTCTTGTATAGTATATCCCATATCCATCTTAGTGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTTCTCGTACATC
GCTCATATCAGATCCATCGTCATTCCATACGGGGTGCTGCTCGCCATGGCTAATCCACCACAGGCAACTTGCACCCGTGCCAAACAACCCAAATCCTCTA
TAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGACCATTCTCTTATTTCTGAGAAAGCACTTCACCACAAGATTAGGTCGGTCCG
GGTAGGACAAAGTCTCGCTACGCGCGAAAGAAAGTCCCGCATACTCAGCGGGCCGGTACGTCGGATAGCCCGGGTGCCGTAACACTTCTAGCTGAGCAGC
CTCTGCGCTCGGTGACCTGTAAAAGCGCTCGCGCGCCGTCGTCCATCCTTTGGTGGAGGGCACAGGGTTGTGAACGAGCTCAGCCGAACCAAACTCGGCG
GAACCTCGGAAGTGATCTGACTTGGTTAGTCGGAACCGAGTGCTAGCGAGCCACTCGTCTGTCCCGGAAGGGCCGAACCGCGAGGGGACCACCCTCTGCG
CAGGCCATACAACCGCCGACCTAACTCGGCGATTTGTTGTTGTTTGTGTAAGGAATCCACATCTGACGGTATTTGTGTGTTCTACTACACCACAACTGGT
GCCGCGACCCGGGAACAGGAGTCTGTGCTTGTTTTTATAGGTACCAGCTAACCAAGTTAAGAGGAAGAGAAGAGAAAAAGAAGAGTGAAGATGGTCAAGG
GATCAGCAACTCCGAGCGACGGAAGCCCAGCGATGGCTGGAGGATCGCCTCTCGCGGGGTCGGACCCGGCGGATCAACGACTCATCGCCATGACGATGGA
GGTGGGACGAACCATCCAGTTCGACGAGGATGACCAAGACCAGGAGAGCGAGAACGGAGATGCAAGCGAAGGAGAGTATGAAGAGAAGTCCGAGACCGCT
GAGCTCGGAGAAACGAAGACTACCGCCGAGCTACTTGGCGAGGTGGAAGAGTTGACGCTGCAGGTGGGACGCATGGGAGCCCCACGTCCTGTCGAGCGCA
ACTTATCCGCCGAGCTCGACGAAGGTGCGGACAATGAAGAAGAACTCCCCCTCACATAGACCGCGTGGAAGGATCCGACCATGGCGGGCGTGACGAATGA
GCGCTACTGCACAGTGCTGCTGCAGCAGGTGACGGGCGAGAAGGCGCTTCCTCCGTCGCAGGATGAAATCCTCAAGGGCCTCGAGTCGCCCAAGGTGGAG
CTTAAGATCCGCGCCGTCAAGAGCGCCATCCTCGCGCTACTACAAGGCGAAAGACTGCCAAGGTGTTGATGCACATTATCCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCACACTCGGATACCGCT
TGGATGATCCTTGATGACGCATAGATTGGGTCAAACTGCTAACGTGGTACATATTTAACCCGTTCGAGTGGTCTCATACGAAACGTATTGGTCGCAAGGT
CTTGCAGCAGTATTGTCTCCACTTCTTTTCCACGCCACGACTGCACATTGCCTGCTGGTGTTTGCAACTGCGAGCGAATTGCATCGACTGCTTGAATTGT
GTAGCGTGAGCTGGCAATAGCCTCCACTGCCAACGAAGAATAAGTCAACTGACAACGGCTAGGCGAGCCCAAGCCGTGCAACCTCCGTTAACAGCTGTGC
TACAACAGAAGTATCAAAGCCCAAGCCGTGCTACCTCCGTTAACTGCTGTGCTCGTTGTAATGCCAGCACTCTGTATTCAGTAGTGAGTGCCGTTCCATT
AGAAACTGTCTAAGCGAAAGGGATCGTTGGACCTTAATACAAAATCGCCAAATGGTTCGACACGTCGGCAGCGTTGTGCAGTTTTAACTGTAATAATAAA
GGCGTGAAGCGGTGTGGTGCTGAGGCTTACGAGGAGGATGAAGAAGACGACGACGCCTTCGACGTGAGAGGTAACCGTGAAGAAACCGTGAAGGACTACA
TCCGAAACTTGAGCTTTGACGCGGCTGAAGAAGACTCGACGCAGTACCTAGAAGTCCAAACCCACGCCTCACTCGACAAAACAGCCGAGTTCGAAGGAAA
GCGCTACCGTCTGACGCGTCGCTCCAGTGGCTCAAGCGTTTCATCTACGATATGAAGAGCACTAGGATGCCCCAAAGTGCCTGGTGCGAACCTTTCTCGC
TATGCTTGGGACGCGCGGTGAAGAGTTGGTATAGGCAGCTGCCGAAGAAGACTCAGCGACGTTGGAAACTACTCAGCGAGGCGTTCCTGGATTATTATTG
TTCACAGTTTGACCA