Description :
From Genome Similarity Track
Location :
Scaffold_37:104717- 131451
Transcript NameFunction/comments
Phyke_g2216hypothetical protein
Phyke_g2217hypothetical protein PHYSODRAFT_466927
Phyke_g2218hypothetical protein
Phyke_g2219hypothetical protein PHYSODRAFT_353505

Sequence
26734 bases(100 bases per row)
CCATGGGGCAACAGGTGTCACTTCCTGCGGCAGTGACGCAGCCGCAGGGTGGAAGCGAACGCGGCCAACTCCGACCCCTCCATGCGCCTTATGTACCGCT
CTGTGACGTATTGAAGGCTGGCGAGTCGGGCGTTGCAGTATCGTCGACTTCCGAAGACATGAAGGACGCACTGGACAAGATCTTGGAGTTTGGGGCGTCA
CTACGATACCTACCGAAAGGTAAAAGCGTAGGTTCTAAAGGTAATTGTTGAAGAGTTCTAAGTCATTTTTATCCTGTACAGAGAGTGAAGTATCAGGGAG
ACTGCAAAACCGCAGTCCGGAACAACAGATGAAGGAACTCATGAGCTCTGTGGATTTAGTGGAGGAACTTTTCCAGCACATTTCTCAACTGGCAGGACTT
CCAGTTCAAGATGGCTACGATGGCACAAGACACGATGGAAAACGAGATGTTGGCGATGCCGTGACTGGCATCTTTGATGCTCGCGTGGCCAGCTACGTGA
AGAACTTGCAAGCTTTGTACCAGATGACGAAAAAAGAAAAGAATTGGTACGAACAGAGATTACTGGCAGCACGTGCACATGCCATGTCGCTACGCCGAgt
ttcaccaccaccactaccgcTACCCACACAGAACTGCATGACCATGGGCTGGGATTTGGTGATCATGCTGCTGAAAGCTACGAGGAAGGACAATCCCGAA
CAGTATGAGCATGCGCTACAAATGGTGAAGGACAACTTGAAGCAATTGAAGCCTACAGCATACTCAGACAGTGTTTATCTCGCACCGTCGGCGTCATCAG
CATTCAATCTTCTGAGTGAATGTCTTGGCGACTTAGCACAGCCGCTGACCGATGTGGCGACTGAAATTGAAACACACATGGGAGCTCGCACAATTGAGAC
CTTGGTAGAGGTGGGGTTGGCTCGTGGATCGCTCGCTACGATACTGTTCGTGGTGCTTTGGCTGATGAAGCAACCGCCCAAAAGTGCGGTGAACTTAGAG
GTATCCATCAGCAAGCTTGCAACGCTAAAAGAACAGCCCATGTATGGAAAGTGTGAGGCCTCAGGCGAACTCTATAGTTGCGGGCAGAATTCATACGGAG
AATTAGGCACAGGAGACGACATTGAGCGTCATCAACTCACCAGCGTCTCACTTTGCGGATGGGACGATATCCGACAGGTGGTTAGTGGTAATGAGACATT
GGCGATCCTAACAAATGATGGCGTCGTGTTGACTTGCGGGCTAAACAAAAGTGGACAGTGTGGTCAGGGGCATTTTGATGAGAGAGTGATGTTGCTCCGC
CCTGTGCAAGCTCTGCGGTCTCAGCGGATAAAAATTATTGCGGCGAGCAACGGTTGCGAGCACATGATCGCGCTGACGGATACGGGATTGGCTTACTCTT
GGGGTTACAACGACCGAGGCCAGTTAGGACACGAAAATTTGACAACGAAAATTCACGCCCCAAAGCTCATAGAGTCTCTGAAGGACAAAAAGCTCGGATA
CGCTTCTGTGAGTTACCATCACAGTGCACTAATCACGGAATCCGGAGAGCTCTATACGTTCGGAATGAATGACTGCGGGCAGCTTGGATTAGACCACACG
CAACACCAGTCAACCCCTCAGCTCGTAAAAAGCCTCGAGGGTACTGAAGTATCCATGGTAGCTTGTGGGCTGTACCATACAATCATTTGCACTGCCTCCG
GGGAGCTATATTCATGCGGAAAAAATGACTACGGACAGCTGGGGCTATCCCACAACCGCCAAGTCAAGATACCCACGCTTGTTGCACTGCCAAACGAGAT
GGTATGTTTTGTCGCATGCGGCTACTACCACTCGACCATCGTTACCACTGGCGGCCGAACCTTTTCATTCGGCCGAAATGATTATGGACAGCTCGGAATT
GGAAACAAGACCCACCAAAATGCACCGAATGTTGTTGCTCTGTCTGCCAACACGCGAATGGTGCGGGCAACGTGTGGATGCTATCACACGGTGTTGCTCT
CTGAACAGGGTCAAGTATATGTTTTCGGACGGAATAACAAAGGACAACTCGGGAACCGCGGTAGTGCAGACGCATTGTTGCCTGTGCCATTGAAAGTTCG
TCCGGAGAAGAACTCTCGCCGCTGCATTGACGTCGCCGCTGGTTTCTATACAACATCACTGATTGTGGAACGCAAGCGTGAGAACGATGACGGGGACGGG
GACTCGGTAATGCTGGATCAAAGCTGCGTCGTGCCTGTGTGTGGCCGCGTTGACATTGATCGCTCCGGGGAAATTGAAGGATTGAGCAACTTCGGTTCGA
TATCTACAATTGGAGTATCGCTCTTCGGAGGCAAATGGTTTTACGAAGTAGAAGTGGTCACCAGTGGTTTGATTCAAGTGGGGTGGATCGACGGCTACTT
CCAAGGGAGCTCAGACCAAGGCGAGGGAGTTGGTGACCATGCTCACTCTTGGTCCTACGATGGCAACCGCCAGAGACGGTGGAACAGTGGGTCATCTTCA
TATGGAGAAAAATGGAAAGCAGGCGACATTATCGGTTGTATGCTGGACTTAAACGCACAGGAGATGACGTTCTTCCGTAATGGAGTCAACCTAGGTGTTG
CATATTCCGAGTTCAAGTGTTCTAAAGACGACAAAAGATCGGGAATGATGCCTGGCCTCAGTCTAGAACGTGGTGAAATTATCCGCATTAACCTGGGACA
CCAACCCTTTGCGTACCCTCCGACGATTGCCCGTGATTTTGATAGCATTTCTCGTGCAGTGAGTACTCCCTCTTCCAGTGCGTTGATTAAGGGCACTGTG
GATGAACCCCCAGGAAACGTTTCCGCTATTGGTCCTCCTCCACTGGAAGGATCCGCTTCAGTTCTAGTCGGAAACAAGCTGTTTGTGATAGGTGGAATGG
CTGTGAGCGACTCCTCTGCTTCTCAACCTTCGGAGCCTACCAACCATGTGTGGGCATACGATATTGACACAAAAGAATGGGAGCGGTGGACCGATTTCCC
CATTGGAATTCGCCATCATCAACTCGTTGTGATTGATGACAATCAAATTCTTGTGCTTGGCGGAGAGAACAATTGTGCGGCATCGCGGCACATGGACCTG
TACAAATGCTCCACCATAAAGAACGCTGATGATTCGCTCCCATCCTGGACGTTAGTCCAAGCTGCAATCGGAGCGGCAACGTCAATGCCGCAAGCTCGCG
CGTTTCACACGGCCTCAACAATTCGTGTTCGACTCGACACGATTATATTCATGTACGGCGGCAAATCCGTAGACAATGAAGCCCTGGGGGACGCATGGTA
TTTATCGCTCGATGACTACGCTTGGTCCCGATTACCAAGTTCGGTGTCGCTCGATCCTGGGCCACGAATAGGATGCTCCTCTGCAGTTATTGGCGAATGC
GTATACATTTTCGGCGGGCAGGACCGCGAGGACAAGTTCAGATCAGACCTGTGGCGGTATAATACGTTTGATCGTCTCTGGCATTTGTGTCACGATGATA
GTATGTCAACATTGAAAGATGTAAGTACAAACCCGGGTACTTTAACGGGTGGAAGTTCCCGAAGTGATTTGCTACCAGTGGCTCGAGTAAATTATAGCAT
GTGCTCTGATCTAGGAAATATTTGGGTTTTTGGAGGTGCGGATCGAATAGGGACGCCCTTAAACGACTTGTGGTGCTATTCTGTGACATCGCAGCTGTGG
AATCACGTCGAAGTAAACACTGAAGGAGAACTTGATGGGTGTTCCTCAGCAGCACTCTTCACGCGGACGGGTGTCGTAACAGCGTTATCAAGTATGACAA
ATTACGATATATCCGCTCCAAGGGGTGACGACTTTTTCATGTTCGGAGGCCGCATGAGTAGCAAAGGGAAATCATGGAGCTGCAGTAAAATTCGAAGCAT
ATGCTCTGGAGACCCGTCGGGGTCGTTTAACCTTGATGTGACAAAAAACATTTCGACAGCAGGAAAATCAGGACATGTACTCAGTGCTCTCCGAGCAAGG
AATAGTAGCGCTGGTAGCCGACCAAGCCAGCATTGTTCCGCAGAAACGTTTGACTCAGCTATTTGTTTGCTGTCTCATCTGGATCGTTTGGTCGGAAACG
ACATTCCAGTAGAAGATGCCGACTCCGTTCAACTTTCGCGGTGTTTGTATCGATCTCTTTGTATTGATACAAAGGAGACGACATTTTCAGCCTTATACTC
TCTGTTGGAAAACATTACGTCGCGATTTTTCAGTATGGATGTATTAGATGACAACTCAAGCAATTTGCCGTTACTGACCCACGTGCTCTACCCACTTCTG
GTGACGatcaagctgctcaagtttAATTTTTTTGAGGTATGTGTTTAGCCACTGTATTTGTTGAGATTATGCCGATGTTTCCCCCTAACTCGATTATCAC
TGTAAATGGAACAGTTTTCACGGAGTTGCTTAGACGGGTCAGAGATTGGATTGCCAACAACGGCTATTCAACCAGGAGGAGTTCTCTATTTGATCCGGGA
GCTACTTTTCTCAATCACGGATCACATGCCAAAGCTCTCAATATCTGGGGAGACGCTATGGTGTTATCATGCAGTGAAGCAGGAAGCTGCATCGGCAATT
TATTACGGGTTCCCAACTCTTTTTCCGTCTCTTTTGGATAGGTTGCAAGTGATGAACCGCTTGATGGCGAACAAGCATTCCACTGAAGCGAGATCAACCC
CTACGCAAACACTGTTGATTCCGATGCTGGTACCACGTTTCACATCAGCAAAAATGCTATTTCAGCTGATGAGTGATCCCGATATGCTGCTAAAAACTGA
AGGTTCATCGGAAGCTGTCGTAACCGGAACTGTCATTACGTTTATTGATACACTATTGGATGCGCTTTGGGACAAGACAAAAGAAGTGATGGGATTAGAG
GATCCGTCCAATCTCGTGAGAAGTTTAGAGGCCCTTGAAGGTAATCACGAATTCAAGTGTTTGAATATCATGCTGCGGGCAGCTACATTCTGGTGTTCGT
GCTCCACCACCCATGGTTGGAGGATAATTGAATCTGTGTGCGCAAGGTTGGTGAATTTTGTATCTGAAAACCTGGATCAACTCAAGACCATGCGTGTGGA
ACAAAGCCAAACCCTGCCAATCCTAATCCAGCGTAGTTTTCCTGGCAAGCTGCTTCCGTTTATTTTACTGAGTGTCTTCTCGCTGCCGTCAGTGCGAGAT
GGTCTGCCGGCTTTGCTTGATCCGTTCTGGCCGCAGTTGGAAGTTCTTTCAGTCAAGCTCCATGGTGCACTATCCGTTTTAAAAGACCGAGGAATGCTGC
AGCCAACCACTATAAACCACCCGATGCCTGAAGCTTCTGGCGCAAATTCGAGTGAAGCGGATTTCATTGACAGCGCGTGCGTAACTGTTTCGAAGGAACT
GGCAGGATacctcttccagcagagTAGTGGGTATTCTGCCACGTACGAACGCATTTTCAAGTGCTTGTGGGACAAGATTACCCAGTCGAAGGGGTACACA
TCATGGAAAGTAAAGGACTTGCCGCTGGATGCGGAGATCCGCCGATTGAATGTCCCTTCAGAACTTGCAAAGCTTTTGGGGACTGAAACACTTCTTGTCA
GAGTCCAAAAGAGTGGGGTAGAAGGTGGTGTCCAAGAATATGACTCGAAAAAAGTCACGTTTGTGCCAAGCCGTACGATTCTGTCACAACACATCTATCC
CATAGGTGAGACCCACCTACCTGCTGCTACTAGAGCAGGAACTGTCGTGATGCCTCCTCCTGTGCCTCTTGAATCATTAAAGGTCAATTCTCCAGTGACA
CAATGCGCCGATAAAACGCTCGAGGAAAGTCATGAGTGGCTGAAGGATCTTCAGAAGGTGTTAGCCTGGATTGGAAGCCATTATGCTGCAACGTTAGTTG
TCGGTTGTGAAGTTGATACCGGTGTGACTGCCAGTGAGCGGTGGCTCAACTCGCCACTATTCCGTGGTGGATTAGAAGAGACAAAGCCGTTTAATTCGGA
AAGTAGCGAGGTAGATCGGAACGCAGCCCTTCTTCAGCAAGTGTTTGACAACGTCGGTAATGGCAAAAAACTTCTCGACAAGGTTCGAAATGCTTTGGAT
CCCGGATCAGCACCTGGGGCGGGTGGTGCCAATCCACAGCTGCGAGTTGCAAGGCTGAAGAGACAAGATAGCGTGGAGGCAACACTGGAAAAGAGTGGTG
GAATTGAGGCTGTTGATCGTGCTGTTCGCGCCACCTTTGCAGCTCTCCTGAAGCACACTAATATTTCCTACACCACTGAACCTATTTCAAGTGATGGTGC
ACTGGCCGAGACGGTGATTGACGCGTGGAGGGCTGCTCTCCAGCTTCGTAGATGGTGCGTGATTTTGTGAGTTCAATATTTTTGTTTCGCATTTACTGAT
CTTTATTCGTTGTGTATATTTCCGAGTTTAGGATCGTGCGAGAACAGCAAAAACTAGCAGCAGCTGTCAGGTATAGCTTTATTTCTTCGTAGAGGTTGTA
ATGTCTCGTTGTCCTGGTATTTAATTTTATTTTGCTTCGTTGCGCTCTGACATCCGGTAGTGAGACGGGAGCTCCAAGCTCCTTTTCTCCTGATATGGAC
GTGAAAGAACGACAGAAGGCTCTATATAACGCTGTCTGCGAGCCAGTCATTCGCAGAGCACACCTCTTACTCCAATTGGCCCCTGCTCCAATTCAGTGTG
CACCATCGGCATCTTCTCCAATGAAGCTCCTTCCGGGGATATCAATGGCAACAACTTATGGTGAGTTTTCTGAATGTAGACGTAGCTGTGTTGATGGTGT
AACACTAAGCGCTAACCCTTCTGTTTCGGTAGATTTCTCGACAGCGACTCAAAGTGGTGAACCGGCGTTGGCCACAACGGAAGAGCCTGAGAAAAAGCGT
TTTATCCGGCAGCTGAATAAGCTGATGGAGACAAAGTCGATGGAGGtgatggaagaagaagacgagcgCATTCATGCCGATATCTTCTCGTTCATTCAAC
AGTCAAGTAGTTCCCTGGTCGCCGCTAATCGCGACACAGAGACGACAACTCGGTTTGCCGAAGATCAAATGCGTGATATATTGCTCGCGCATCAAAATCG
TGCAGAACGGCGCCTCCAAGGGCTCAAAACGTTCATTCGTATGTTTGAGTACACTGAAAATATCCCGAGTGTGCGGTTCCATGTTATCCCAATGCTCTCA
TCTGCCTTCAAGCGCGTTCGCGTACACAGTGATCGAAGTTCAGCAGGAAAAAACTCAATTGTCAAAGTCCACTATCTTGTTGACCTGGAGTTCGCGGGGC
CTCGATTAGCGGGTGCCATTGGCAACGAGTTTTTCCATCTGCTGACATTCCTTCTGAAGTCATCTACGGATCACTTGCGTCAAgttcaacagcttcttga
agctggagTGGGTGGACTTGGAGAGATGAAGTCGCCATCGTCTACGGTTCAGCTCGCTGTTCATGAcatgctgcttgtgctggaaACTTGCTGCTTTCCT
TATAGAGGACTGGACTGGGATCATCTTCACCGTACAAATTTGGTATCATTGCTAACTGAGCTTACCAGTTGGAAGGGATGGCAAAACTTTATTCAGTACG
ATGCAGCAGACAACTCAACGGCCGACATTGACGGCACTGAGAAGAATATTATTCTCCCTGCCGCCACAGGCTCGAAGTACCCGAACATCATCTGTTCGCG
GTATATTACGCTTGGGACCGATCTCCATAAACTCACAATCACACATAAGACTCTTGGCGGAAGCGATGATAATACCCCCACGTTATCTACATCGCAGGAA
ACTGGAGGCCTTGCCGTCTTCGATAAGACATTTTACCGGGGCCGATGGTATTGGGAAGTTACAGTCCGTACAATTGGAGATACCCCTGTGTATGTTGGCG
TGACTCCTGGAACAGCGGACCTGAATACGTATGTTCCAGGCGAAGGTAATCTCTGTGGAGTTTTTCTCCATCGTGAAGGATCCAGTAGTAATATGCTTGG
GTGTGCCGGAATTCGGTGGAATTGTGCCGACGTACTTGGCGTACTGTTAAATTGCGAGGAACGGCAAGTTGAATTTTACATTGGTGCAAGAAGATGCTAT
GTTGCTGCACTATATCCAAGTGATTTATTCGCGTGCGGCTACTTTCCTTCGATTGGAGTCAAGGACGCCGATGTACATTGGAatcttgctgcatctgccc
CAGCAAAATTGTGGTGTGCCTGTTCAAACTTCCAGTTCCCTAATGAGATGGCATCTGGTGGGCTTGTGGCAGTCCCTTGCGATGGAGCAACTATCAGCTG
GAATGGAAAACGCAGAGGAAGTCGCCTCCAACTTATGCCTAACGGGACAACCGTAGTCGCTGGTGATTCTAGCGCATCTGATGAGCACTTCGAGACAATT
GTTGCAAGCCAAGGGTTTGAAAACGAAAGTATTTTCATTGAGATCCGTATTATCGCTGCTGGAAAGGATGGTCGGTCTTCACTGAGCTTTGGCATTGTTA
GTGGTGACTTCTCAGAGTTTGATACTCCGTTAAATCATAAGCTCGGCGTTAAGTGCAAGAGTGCAGAAGAAGTATTGCAGTGGGAGACATTCGGCGTTTT
ATTTGACTTTGAAAAGGCCACTGCGACGCTGTACTCAGAACGCTCGGAGCCCGAAGTATGCAATTTCAATATTGCAGTCTTGGGCAAACCGCTATTCCCT
GCTGTATCTGCGCTCTGCAATGGTACGGTATTTGATGTGAACTTCCACCCCCGCCCCCGCCTCGAGCTGCCCTCGCACGCATTTCACCCCGCtcgccagc
accaaaatTATCagttgtcgtcgtcaaacGAGCTACAGCTAGGAAAAAATCTACAATTGCAAGTTCATTCTTGCGACGGTGGGGAGTTCAGCAGTTCCCA
TGGCGCTCGGAACTGTTTGTTGGACGACACGTCAGTGTATAGTTCCACCAAAGGAACGAATGTGAACCTGATATTCAAGCACGAAGTCGACACTCCCATG
TGCGTGAGTTACATCAGTATCCGGGGTCCTGGACCGGGTTACTCAAGCCCGCTCCGTTAtgccgtcgtcttcgttACTAGCACTCCTCCTGACTTAGCTC
GCTATCAAGAGTTTGACAACATGACCCCAGAGGAATTTGCAGTATTGCCGTTCCCACCTAGCAATGGTCGATGCCCTCGTGAGGAAAGCGTACCTGTTGC
CTTCATCGTACTGGATGGTAGCTGCTCTCAGATTTCCAAGCAGCTCGCTTACCCAGTCACAGGTCGTTACATTCTTGTTAAAGCGATATGCCCATCATTA
GGCACGAACATTGACATCGGGTACCTTGGTTTTTGCGGCATTTTCGACCGTGAAAATGGACCAGCGTATAGTGAAAGTACAACGGAGTCGTACAGTTGTG
AGGAGTGCAGGACGGTTCCATTGTCCGGTATCTACTATGGCCAGAGAGACGATGACAGTGTTAAGCTATGTGCTGCATGCTACGATGATAACCGTGGTGA
TCTAGACTCTGCTTACTACGTCCACGCGTCCGTAGATTCTCAAGACGACCAGACCGATGTGAACACACTCCTTTGCCCGCCACGAAGAACATGGAGCGAT
AAGATCGAGGCACTTGGCGATGTCTTGAAAAGATCCAAGTCGCCTATTGCTACGCGCGCCGCCggaagtgcagcaacaaatgcgGCAGGGCAGGCTGGAA
GGTCTGAAAGGTTACCTAGCGTGGTCAGTTTTGATGATTGTGAGCTGTTTTCCTGTGGGCAAAATAATTATGGGGAACTCTGTTTGGGCCACTGCAACTC
GACTAGCAAACTGGAACATGTTCCTTTCTTTTCGTCCAAGGCAGTCCGTGATATTGCTGGAGGGAATGAAGTTCTTGTCGTGGTGATGAAAGATGGGGGT
GTTTTCACTTGCGGTCTCAATAAAAGTGGTCAATGCGGCAACGGGACCTTTGAGGAACGGGTCATCATCGCAACTCCCGTGCGTGCGCTGAGTGGCATCG
CTATTAACatggttgctgcagcgaatgGGTGCGAGCACATGCTGGCCGTGTCTTCGGACGGTGCTGTGTATTCTTGGGGATATAATGACCGTGGGCAATT
GGGTCTCGGTTCGACCATTTCGAAGAGCCATACCCCTCGTATGATTGATAGCTTACGCGAAAAGTACCATATTACGACAGCTGCAGTGAGTTATCATCAC
AGTGCTGTCGTATCGAGCAATGGAGAGTTGTTGACGTTTGGTATGAACGACTGTGGGCAGCTAGGACTAGACCACATCCAGCATCAGCATACTCCACAAT
TGGTGGATGCATTAACGAGCCAAGTGATCACTAAAGTGGCATGTGGGCTGTATCACACAGTTGTAACTGCTGCTAGCGGCGAGGTTTATTCGTTTGGAAA
GAACGACTACGGCCAGCTGGGATTAGGCCATGCACGTAACGCGAAAGTGCCGACGCTGGTCAAGACGTCGATGGGTGAGAGCGATGACAAAATTGTAGCT
GTCAGCTGTGGCTACTATCACACAGTAACGATAAGTGAGAAGGGTAAGCTCATCACATGGGGAAGAAATGACTACGGCCAGCTTGGCATCGGGAGTAAAG
ATCACAAGAACAGTGCCCAGTACGTGCCACTGCCTTTGTCATCAAAGATTTCGACTGCTTCGTGTGGGTGTTACCACACACTTATTTTGATGTCAAATGG
CCGGGTCATGGTATTTGGCCGCAACAACAAAGGTCAGCTTGGAGCTGGGTCAAGAACACTTCCATCTGCAGACTTGCCATTACCCGTACCATCCAACTCG
CTTGCAAATGACGAAGTGGTTCTAATAGCGGCAGGGTTTTACAGCTCCTATATTCTTACTGGTCATTCAGAGAATGGCGGTTTGGATGCCGCAGCCGATG
ACCTCAGTCAGGCGAAAGATCTGCCAGAAAATAGTTGTCTGGTGAACTCAGATGCGCTTTTTGAGTCGCTAATGAAGGAAATTGATGCCAAGTACATTGC
CGACCAGTTGGTTGCGAAGCGCGCGCCGATTCAAGTCAAACGTAGTTATCCACAGCGAAAACTGCCGCTTGTTAAGTTGCACGCAGCTGGGTGGGCGGTG
GCTCGCGCTTTGATGTATCAATCTCTTCGAGAGGTTGGTGAAAGTACCAGAAGTCGATCAGGTCGCGTGAATCCTGTTCTGTCCACGTTCATTAAttttt
tgctggagaatCTGAAGTCGGTGGAGGCCGACTCCAGTGCAAATACGGCAGGGTCATACCAGTTGGGCACAGTTGTCTCGTTGAAGCGAGTATGCGTTGG
TCTGCTGCAGTATTTTGGCTCCAAGTTCACTATCTCTACGTCACCTACGTCAGGAATTATCGAGGGGGGTCCTACAGATGGTCTTTATGCCCAATTTTAT
AGAAACCAGATTCTAAGCGTTCTTTTGACGTGCGGTTCGACAAACAGTGATGTTGGCGCAATTATCTCTGCTAACTCAGTGGTGACAGCTCACATTATTA
CTGGAATGAACTCTTCAGACTTGGCATCGGCCATAATGTGCATCCGGTTGGCGATGTTGGTGTTCCCGCAACATTCCGTCTCAGCAATCAACAAAGCCTA
CCGTTCTCTACAATCGACCCCTACGTTCGCTGGAGATATCATCAGTGTGCTTATGACTTTGGTGGGACTCCCTCTTCTACTTCGCCCACGCCTCTGTTCG
CATGAACTGGGTTTGGAGTGCTCAAGTACAAACCTCTGTCAGTCAGCGCGATGCTTAAAGGGTGTCTTGGTGACCAAAGACTCTGGTGTTGCTCATATCC
AGCAGAGTATACTAGAAAAGTCACATGTAGCCGAAGCAAAGGCAGCTGAGGTGGTAGCACTCCTGCGTCACCTCACACTTTATCCAACGTGGAAGGTTGC
CGTTAATGCTGCACTTAGCCGAGGCTTCGCTAAGTCAGAAAAGGTTGGCGAATTACTTGACACCGTTTGCGCATACTACACCAATATCCAACAGGCCGAC
GTTACAACACTGCCAATCGTAGCAATTGATGCACTCAAGGCAGATAACAATTCTACTTCCACACTGAGAAAACCAGAGTCGACCACTTCGTCCCCAGAAA
CCGATGAGACCATCAACAATGCGTCGGAATGCGATGCATCGGTTGAAGAGGCTGATTCCCGTGCGAACGCTCGAGATAAGCACTCATTAACGCTTTGGCA
GAAGGCGAAAAACGCTCTTGATGGACTAGCTACGATTCTGGCAGCCGTCAGCATTGTTGGTGGACATGTTGAAGGTTTCCGAGAGGGCGGTTCAGTCATT
ATTGAAGGTGACGGGGCCCATGGAGCAATACAATCGGGTGTACTTTGCGGCATCAACAAAGATCCACGCACGTCTGATCTTTTGGCTCAAGTAGTAGTGA
ATTCCAATACTGTGGAGCACGCAACACCGTTTATGGGTCCTAATGCGGGTGCACTAACAGTACCCATAACGAAGCTTCAGGTTGTGGAGCGCATTCCTGC
TGTAGTGGACATGTTTGACGGGGTGGACACCATTATTGAGACACTGTCCACTATGGTTTCTTCAGTTTCTTTTATTGACGACGAGAACTCCATGCATTGC
GAACTGGATCTACCCCAAAACAATTCAGTACAGGACGTACTGCGAAACCGACTCAAGATgtacaagcagcaaattcgATGGAGATCAACGAAAGCATTGT
CGTCTCTCCTTAAGCAGATCTCGACCCTCAGCCCTGCTCTTATCACTGGGGACTCGCAACTCGTGTCAAGTGTAGCAGCACTTCTGCACTCGGAGAACCC
GTTATCGTGGGGGGCCAAGTCTGATACGCTGACACCTGACACTGTCGGCGCTCTTCAGAAACGATGGCTTTGTGTTAAACAGCGACAAACTTTCTTGGAT
ACGGAGGAGGTAATCGATACAGCTTTGGATCAGTATGAAGGCGCGATGcgtgatgaagttgttcgTAAGTTGGGTAGCGAGAACGCGCTGAGCTGGGGAA
TGGATGCCATTCAGTCGCCCCGACGGAAGGTGAATCATCCGTCCTTTGCGAGCTCTACGCCTACCGGATTCGGTAAAAACAACTCGCGTGGGGGCGGGAA
TCGATCTGACAGACCGAGCGGAGATCTCCCATTTGGTGCATGGGGAGTTTTGGTACCTCTTCCGCCATTAAATGAGAATGAACACACCAATAGTGCAGGA
GCTTCGGGGCATTCGGCTATCGACTACGCGCCGTTTCCACTCACCGCGCCCATCGTCCGCGTCGGgcgtgctgcagatgctTGCGATCTTATCGTAAATG
ATCGAAGTGTGAGTGGCCGACATttccatcttcgtcgtgtTCGGCGTGAAATTGAAGGTGGTGAGGTTCAGTATGAGCTCCAGGATTTCAGCAAGAACGG
CACGATTGTTAACGGTGTGCGCGTACACGGATCCAGCACACGCATAGCCACAGGATCGCGGATCTCATTAATATTATCACGAGGCGGGTTGGTGACCTAC
GAATTCCAAGTTCGACCCCCTGCAGGGGTCAACGGAAGCCGCCTTGCACCTCCACCTATTGCCACAGCGCCACAGAACCCAGGTGACCTCAATATTTTGA
TTCCTGGTCAAGAGTATCAGCAACCACAGATTGGTACACCACAGGTTGTAATACCTCGAAGTCCagctgagctgcagaatCGCGGAGGTCGTGGAGTTTC
CAACTCGTCTGATAGTCAAATTGACAACAGCCGCAGTCGCCAAACGGTGACTCAGGGACTACGCTTGATAACGTCTGTATCTGAGAGCGACGTACCTCGC
GCTCTACTATCGCCAAACCCTGCTGTAGATTCACCTCGTGGGGGCGGATATACCTCGCCTCGATCTTCTGTACTCCAAGCTCCTGGTACCCCTACTGTGG
GTCTCCCCTCTGCAAGTATGTTTCACACAATGGTGCCAGCTGGAATCCTCTCTCCTGCTTCGTATCAACAGCGCGAAAGCTTCGCGCCGGGTGAATCCTC
TGGAATAGTACCACCTCGAGCTCCGGAAGGTGGAGTCGGGTCAATGCTTCGCATAGCATTAGGCCGTGACAGTGTAAACCGCGAGTCTTCTTCACAACGT
CTCAGCATGCAGAATGATCTCGCCAAAACTCGAATTCTTCGCTCCAACGGTGACTCCAGCTTGGCCAGTCGCTCGGTGAGTTCATCTTCAATCCTTGAAT
TAGTATTATGTTCTCGTTCTGTTTGGGTTGCACAGCAACTAATGGTGTTCTGTAATATGTCATATACTGCGAATGGTCAGCAGAATGCATCTCCTGCCCA
AGAACTGCGGATTCTTGCCACGCGTCTACTCTCGCGTGTTAAAGAAGCAAACCTTGGAGCCAGTGTTACAGAGTGCGAAGAAGCACTTCGCTTGACGGCT
GGTAACGTTGAGGAGGCATTTTCGGTTATCCAACGAGGTCTCTGCGCAGACTCGGTAAGTTTTGGTATAGCACCCCTTTATTCAAGCGCACATATCAAAG
AAGCGTCACATCACATTAATGCTATTTTATTGTTGCGCAGCGGGGGCATCCTTCAAACGTACGTCACTTAGCGATGGTACTCGGAAAAAGCGAAGCTGTC
TGCGCGAAGGCACTGCGACAAACAGGGGGAAATTATGGAGATGCTATACGTATGCTACTTTCGGGTCGTTGTGCTGAATTGGAAATgtctgctcctgctt
cattTTCTAGTCGCCGAGATTATTTCACCGAAAACTCTGAGACACAGGCAGGAGAGCCTTTACTTAATTTCCAAGACGTTGGTGATGAAAATCCCAGCTA
TGCGCTTGCGGAGTCCAGTGCGATATCTCCTCCTATGCCTCTGCGCAATGCTGCCCGATCGATGGGAAGTCCAGTTAAAACCAAGAAGGTGGATAACGGT
GGCGTCGGTGTGTGCTTGGATGCTGGGCAAACGAAATCAGACTTGACCCTCTGGAGTgaatgcaacagcagctttgacagCTCAGTTCGTCAAATGAACG
CGTACGAAATAGAGCTGGAGGAACAGGCACTATGCCAACGACTCGTAGCAATTCACGCACGGAGGATTCTCTTCCAGATTGCACGGCTGTTTACTAGTGC
AACGCAGAACGAAGATGAACCACTCAGTGCGCTGGGCGATCAACTGGTGTTACGTCGGTTGATCTCATCTTTGGACGGACCAGGGCATTCAAACAACGAC
TCATATCAACCAGAGAATCACCTGTATCGCAAACAAAGCGATGGGAAAGCTCAGCAGATCCTCTCACGTATGGTACGCGAAGTGATGGTGCACTCCCCCG
CGCAAACATTGGCCGGAAATTTAGGTTCCGCGCAGAATTTGGCAACTCTTCATCGATCAATCGATCAGGCGACGGAGTATTCGACCGAGGTTGGCTGGTC
TGGAATCACGCGGCTCATCAACGGTTTCATCGAGAGCGACATCAAGAATGTAGACGACACTAATGATTTCTATCAACCTACCTCACTAGAAAACATCATG
TTCGAGACGATCCTGCACATTCTTTCGCGCACACACGCAACTCCAACAACGACACCCAGCTGGGAAAGCTCACCTCAGCGAATACGAAAAAGCGATGGTT
ACTATCCCAAGGGGCCACTGCTACTTTCTTGTGGCCTTGAGGCCGTAGTGGTTGACTCGTACGAGCGCTTGTGGAGTGTACCGCCATCCGACCCATTACT
CAAGCACCGTCATAAATGGCGTAAGaggttttcttcttcgatgGACGGTGATagcagctggatgaagtCATCAGCTGACCACGCGGTCACTATTTGGCGC
CCAACgctaccagcagctcttcaagcaTCGAGCACCAAGACATGGTTCTGTCTGGGTGATATTGTCCAATGTGGTAATGGAGTCCCCGACGCACCTATGC
TTCTCGTCAGCGAAACCGATGGCCAAGGGCTTTTGTTACCGCCCGTCAGCTTTGAACGCGTGGATGTCACCGGAAAAGGCTTGCCGAAAAACTCGGAAAG
CGACCCTGATTTTCAGCGCAAACAATTGCGCTCGATTTGGTGGCCCGTAGCGCCTCCTGGATATGTGACACTGGGTTGTGTAGCAGGGAGCAAGGAAGAC
CCTTTCGAGCCTCCAGAATTATCTAGTGTACGTTGTGTGCGTGAGGATCTCGTTAGGCAGGTAGACATATTCCACTGCGTATGGCATGCGTCATCTCCAG
CGTCTACGGGAGGTGGAGGTGTGGAGCTTCCAACGACAGTTGAGATtgacagtgacgaagatAACAGTGACGTTAGTGGTGAAAATGGAACTTCACGTGG
TCGTTGTATCAAGAACCAGACTGCAGACACGTCACGGATGCAGTTATTGCTACCTGTCgccgatgatgttgttgtaCAGACATCGCTTTGGGCAGTAGAA
TCCGACTTCGGCAGCGGTCTGCTGCTACCAGTAGTAACTCTCAATGATTCTAGTGCTGGTGAGACCAGCGCAGCATTCGCATTAAATCTTTCTGACGAAG
ACCGCGTACTATGTGCTCCAGTAAGCATAGACAACGTGCTGGCCTTCATTGAGGTATTGCTACGACACCAACGGCTACTGTCCAGCAAGCAGCTAGAGAT
TCAAGCCATCCCAACGCAGCTACGACCAGAATTGCCGGCGGCTCTCTTTACtctcgtgcagcaggtgctACATGAGAACCAGCCGTCTAGTGGACAGGCC
GCGGTGTCCCTTGTACGCGCGCTAACCGCAGTGATTGAGCGTGGCGCACACTGGAACGACAAACATGCACTTCTCTACTGTCGTTCCAAGATAATGGCTC
TTAGTCAAGATCAGGACGGTGGATTTATGCTGCACTCTCTGCTCCAGGCTTTTGTGGAGTTaatgcttgctgttgagGATCAACAACGTGGTGAGCGTGT
CCGAGATCTTTCTGCCTGTCTCGAGCACGATACTGGTGGAGTATTAAGTCTGCCATATCGTTTCCACTTCTCGAAGCAACCTTTTGTGGAGATGTTGGTG
AGCCATTCATCAAAGATGGCGGTCACGCGGCATCTTTCTGGAGAAGAGCGGAAGTTTTTACTGGACTACCGAGCTGATGATAGCGAAATTGCAGCGGCTC
GAGAGGCATTGGTAGCTGAGGGTCTCGGAGTCCCCCCTGGAGAGGTGTACTCATGCCGCTTTGAACACACACCGGCTCTTGTAATCACTATGCGAGACGT
GGTAAAGGCCGAAATTGTGTACTTCGAGGTTACAGTAGTTGAATGGAGTAGTACCAATGTGGGAGGCTCTCTTGCGTTGGGATTCTCGCCGCCATCATTC
CCGCTGGAAGGAGTTCTGGTGGGTGGCACCGCAGACGACTCCCGATCGTATTCCTTCACACCGGTGAATGGCCAAGTGTTATGTGCAGATGACACAATTG
TGGACCGTTGGCGCTGGGTTGAGCCTGCAGGTGCAATAAGCACCGGTGATGTGTTCGGTTGTGGTTTGCGTCTTGACACACAAGAAATCTTTTTTTGCAA
GAATGGCCAGCTGCTAGGCACAGCGTTTTCGAGCATCCCGCGTCCGGAGGAGTTGCATCCGACCATTTCCTTCAACACAGACTGCAAACTATTGGCAAAC
CTAGGAGCTaccgcaacgacgacgaccaaaCACGCCAATTTCAATTTCCGTTTCCACTCACTCGATTGCGATAACCTCATGAGTGCCTTTGAGTGGTTCG
AGCCATTAAGCCAGGTTTATGGTGTCATGAAAGCACTGATGGATCCAGCAAGGCCGGACGAAGTTGACGCTTGTGACGTAACCACGGAGGAAAATGCCGA
TGCTACCGtggcagcaccactgccTGACGAGTTCATGCTTTCAGCTGACAATTTCTTATCGGATATTTCGGAAGACGTATGTATTCGCGTGGAGAGTGCT
CACCCTTACGACCTCGAGTTGCAGGAGTCACTAGTAAGTATTCCATTGGCTACAAGCATTCGTATTCGATTATCCCCTCAAAGTGAGACGGCCAGTTCTC
ACTGCCTGCAGATTTTGCAAGGTGGAAGTACTTCAGGGGGAGATGGAACTGAAGGAGCTAGTGGTGGCGGGGGAGGCGAGGCAGAGGTGCGTGCGTTTAC
GGGTTCTTGTGGAGGTCAGGGGGTCACGATCGACGGCGACAGTTTTGTGTGGCGTTTCCCTGTCCAGTCCAATTTCCAATGCCGCGTTGATCGTGTGCGC
AAGGGGCCATATCTGAAGCTTGAAGCGCGAGATACGAGACTGTCTCTCTCGCGCGATAAAGGCTGGCAAACAGGAATTGGCGTCGCCCGTTTCGACGGAG
GCGTACACATCTGGGAGGTGCGTATATCGTTCGTGACAGCGAGCTCCAATATCTTCCTTGGAATTGCCCGCCGAGACGTACGGTTGGACTCTTACTTAGG
TAAGGATAACCGTGGATGGGGCTGGATCGGCAATCGTGCGCTTTGGCACAATGGTAGCAAGCAACGGGGTACCTACGGTGACAAGTTTAAGACCGGGGAC
ATTGTGCGACTAACGTTAGATCTTCGTCGCGGTACACTGAGCTATGCTCTGAACGGGAAGGACTTAGGTGTGGCGTTTGGTCCCGGAGGAACAGGTCCCA
AACTCGAAGGCACATTCTACCCCGGATTTGCGTTGTACAACCAACGGGACTCAATCGACCTCATCGGTGGTCACCGTGTCGAAGATGGAGGGCTAGATTC
CGGTCTTCCGCGAACTGGCAGTGGTCTGGCAAGTGGAGAGGATTCGTACTAcagtgaggaagaagaggacgtCCTGGCAGAGTCTGGAGGTGAGGACAGC
ATGGGTGATGGATCGGTCCCCAACTTCCGCATGGAGTTGGGCATTGCATTGAGTCAGATGGGATTTCCAATGGAATGGTGTTTATATGCGCTACGCCATt
gcgaagatgatgcagagcAGTCCGCAGATTACATTCTGGCTAATATACATGCAATGGAGTCGCTCgttcgcgaagaagctgaagcgatGGCACGGCGCAC
TCGCCACCGACAGCTACTGCATGAACAGGCACTTTCGCTTTCAGATCATATGGAAAGCGAAGCCTCCGAGCCGATACCATCTCCGCTTTCCCTTGAGGGA
GAACCTGACGCGGTTAGAGCTGCAGAGGAGGTAGCAACAGAGGACCCGAGCAGTctactacagcaacaacagcaacaacagcaatcaTCCGGAGATACGA
AATGGGGAGTGGAATTCACAGCAGTACCGGAATTTTCAGTCACAGGGCGACGGCTGTTAGCAGCAAAGTACGGTGGTAAACTGCGTCGGCTACACGCATC
ACAGCGTATATTTACGCTTGCGCGAGATTGTGCTTTGGTGCAGCTTGTCAATGAGATGTGTGAAACACGTGCCGAAGCTCTGCTGAGTTGTGACCCTTTG
CGCATGGCTCCTGAGGAATTTATCCCCACGGAGGAGCAGCTCCTCGCATTCCCTGTGCTTCGGGGTATTCCACGGgacgcacttcaacaacGGTTTTTAG
TACTGCGAAACTTTAATTGTCGACTTCAGACTTCGCTCGCATTCATTGACTTTTCGGCGCAGGACGATCGATCGCTTCTTGCCCGCGGAGCGCGTGCACT
TCGTGGTGTAGTCTTCCAGCATGTGAAGCTTGCATGGTGGCTTGGTGTATTAAAGGAGCAACAGGCGCCAGCGGCTGCTCGCCCAGAAATTGAGGTTGAT
CGTCATCGAGCCCACGACGCATTGGAGTTGTCTGAGCTCGGTGACCCGCTagcaagtggtgctggtgagCGCGACAGTGTATTTGCACAGACATTCGAGC
AACTACACGGACTGCAGCCAGCCTTGTTACGTGGTGCCGATCGTGCTTTCAAGTGTCAGTTTGTGGGAGAATTCGGCGACGATTTTGGTGGTTTGTATCG
CGAATGCCTGGCACAGCTAAGCTCCGAACTGCAGACTCGCACACCATTACTACCGGTGTTTCGGCCATGCCCCAATGCATTGATGAACACGGGAGAAAAC
CGCGAGCTGTTTGTGCCTAACTCCCACTTGCGTACCCATCCACGGCGTGTACAAATGGCTGAGTTCTTGGGGAAACTGGCAGGTGTGGCTGTGCGGACCA
AAACACCGCTGGACTTGAATTTACCACCAGTGGTGTGGAAGTTGCTGGTAGGACAACAAGTCATGCGTCACGACATCGAGGCAATCCATAAGGGGTGCTT
CCAAGTGGTGGATACGATTGCTAACCTGGCAGCACATGGTATCACTGAGGCCATGTTCGACGAAATTGTGGACGCAAGTTTCACCGTGTTATCAAGCACG
TGCGAAACGGTAGAGCTTGTACCGGGTGGGAGACACCTGCATGTAACATGGGAGGATCGTGACGACTACGCACGCGCTATAGAGACGTATCGGCTTAATG
AGTACGCGCCGGTTTGTCGGGACGTGTCGCGTGGTTTAGCTACAATCCTGCCAGCACCTACGCTGGGTCTTTTCTCGTGGCACGAGCTGCGCACACTTGT
ATGCGGTAAGGCTTCGGTTGATGTAGCTCTTCTGCGGCGCCGCACAATCTACGGCGACGGATGCCAGGCAACGGATCCGCACATCGCCTACTTCTGGGAT
GTTCTCACAGCTTTCAGTGACGAGCAGAAGTCTTCGTTCCTGCGTTTTGTCTGGTAAGAAATCGAGTAGGATAGGCATTTATCTTGTGGTTTGGTTGATC
TAATGCGTGACTTTGACTTCGTATTTTTAGGGGCCGCTCGCGTTTACCCACGCATGCAGCAGATTTCACGCAAGACTTTAAGATATCAGGGCTGCCCAAG
GCTGCGGGCCGCGCCGATATGTATTTACCTATCGCCCATACATGTAAGTTCAGGGTCCATCTGATTGCCCGACATAATGTCCGTGAACTAACAGTGCTGT
GGACAACATTTTGCAGGCTTCTTTTCCATCGATCTACCAGCGTATTCGAGCCGCGAGGTCATGCATGACAAGCTCGTGTATGCTATCATCCATTGCCAGT
CTATTGATGCAGACAACACGACCGTAGCCCAACGGGCTGGCCAAGGCATTAACTGGACGAacactgctgctacagccactgctgccgccacTGCCGCTGT
CTCCAGCGTCATTGCTGGTATGGCCACCGTCGCTAGCGAATGAGCATGCCGTGCACGTATGTCGTGGATACATGCATTTAACACGTATACCAATAAGATA
CAATTATCTTAGCTCCTCTAAGTTTCAGCCGTGGCTTTGTTTGCTGGCGTGCGTTCCTTTTTGGCATCTTTGGAACGAGAAATTCGCGGAGGTACCGCTC
GCTGAAACGCACGCCCCCAATCCCCGTGATTAGCTACCTCGTTCAGCGCGATGATCACAGAGTCCAGATTCATTATATGCGTGCGCACACGCGTTCCAGA
GCGTTGGAAGTGTTCTTGTAGAGGCAGCCGTGCAGTTCGGATGCCGCGCGTAGCcgccttcaacatcgtctCACCCtgctcatcaacaacagATGCCTCG
TGAACAATAATCCTACAAATATAGCTAATGGATCACACTACTTCACCTTTCGAACGGAGCGGTCCACGATCCCACCGACGACATACACACAGTCCGGATC
AACAGTATCAAGAATAGTATCTGAATCTGGTGAAAGGTAGACGAGTTCAGACTCGCGGTAAAGCTGCTCCAGCGGTTCTTCATGTCTTCCGATCTACGCA
ACCAAAGCGACATCGTCTATCAGACTTGGTTTTACACAATTAAAAAAAGTTGATAGTAGTAGCTGTACCTTCCAACTTAAAGCGCCATGCTGAGCACAGA
CTTGCGCTATCTCTGGAGTACAGGATACGAGCTGCAGAGATAGAAGTTGATCCAATCGACAGGTTTTCAGATACCCATACACACACCCAAGCTGCTTCAG
AATACTGTTCCTCTCCTTCAGAATCAAAAGCGCGACAGAACACAACTTTGTTAAACAACAATTTCGAAGGAAAGAAATTGACAAAAACTCACTCGAGGAG
TTTGGCGGGCTGCGAAGGCTAAATCAACTACAACTCGCACTCCATCCAATTGACCGGCCTCTAGTTTTTGCTGCACAAATTCATAGGTTAGCAACCAAAA
CACACTACTTTTTTCAATATGTATATGATTTTTGAAAAACGCACATATTGTTCCACGCGTTGCATACGAATTTGCTCTCGCTGCTCGttcttctgctctt
cagtCATTTCTGCACGCTCCACCGCTAGTATTTGACTGCGTTCAAGTCTTTTTACCCGTAGACGTTCATCTTTGCGGTCACGTCGGTTCGAGCGCACTAC
CTCGCGTCGACACTGCTTAGACAATTTTCTCGGGCTATTCGAGGGAGGTTGGGTCTGGTAACCCACGTAAACCGCATATACAGCGCATGCTGCCAGCACT
ACTGCGCCGATCGTCGCAGTCGGGTCGCGCATCAATGTCCTCCACCAAGTCGACATATGAGCATAATATGTGGATATGATCTATTATAAATTAAAATAAG
TAAAAATCACACTATATTATATTTTAGTTTATATATTAAGTTCGTATCAGATACCGTACTTTGGCTTTTCCAGTCGTACGTAGCATAGCGCccatcaact
tcatccgTAAATCGGTTGGTCATAGCGATGgggaagaagagcaagaagcgccaACGCTCCGAGAGCATCCAGAGCGAGCAAACGGAGGCTGATGACGCTC
GCAAGAGGTTGGCAGCTTTCCACGCAAGGATGTTCGAGCTTCCAAACGAAACGACAACGGCTTCAGCAGGTGCAGAGATGCCTCGAGTGCAGTGGAAGCC
GTCTGGAAAGAAGTAtaagagcaagaagacacAGATGGAGGAAGAATCAGAGGCCGTTCCAATGGTAAAATTCAACAACAcaaagaaggagaagaaaggC
ATGAAGAAGGAAcaaaagaagcagaaagTGGTCGTTgagtcacagcagcagcagaagaagaacaaaaagacTGGACCTGCGGCAATTAAGGTGCCTGGAA
TGCCGACAGTCGCAGTGGAGACTGGTCTCTTCAAGAAAACTGAGCAAATTGGAGCTCACCAAGTTAATAACCAGCAGAGACACAAAcaaaagaacaagaa
aatgaaATTCCAGAAGCAGGTGACGGCGCCAACGCCAGCGGTGACGAACAAAATGCAGGCAATGGAGGCGCCGCAGTGGCATTCGATGAATACAAATGAG
GAGcaagaggatgatgatgggGTGGATCCACTTGAGCAGGCGCTGGTGAGTGTGCAAAAGGAGATCATCAACAAGCAGGTGACGCCGCCGCCTCGCAAGA
AGCGAAAGGTTAAGTCGAGCAAAAGTACTGCGGTCCCAGAGACAGAGAACACCAGGAAAACTGGTAAGAATATGACAAAGGACGACGATACAGTAGATGC
GAAGGGTGCCAATTCTCCGAAAGCTGATGCGGGTTATAACGCGGATGCAGAAAAAGGCAACGATCGCCTAAGTAAACAAGAGATGAAACGCAAACAGTTG
CAAAATACTACGTTGCCAGCACGTACAGAAGCAAAGCAGAAGGCACACAAGTATACTATTCATGCGATGAAGAACGGAGTTACCACTTCTGGGGAAAAAG
TGGAGACTGAACTTGTGAATAGTCCGGCACCTGTGCCATCTCTGAAGACccgcaagaaaaagaaaagaaaaaaagaaTCCCCGAAGGTGAACACCACGGT
CACCCCCTCCCCGAAGATAAATACACCCGCATCACCACGAAAAGGGAAACCACTGATTGTGTCGGACCATCCAGCAGATGAAATCAGCAGCGACATCGAG
GCAACAAATACGCAACACGTTAGCGCTTCGTTAAAGAAGAGAAATACGGAGTCGACGGCAAAACTTAAGATAACTGAGGCACGTACGACAAAGAAGACCA
TCACAGTACTTGGGAAGTCACCGCAGCGTGAATCCATCGCAATGAATGGAAACCATGCATCTTCTCCCAGCTCACCGATGCCTTCAACTCAAATTGGAGC
TTCTCTGGCTGAAGATGCAAAGAAGGGAAACGTAGATATGTTCTTGCCCGCTAACAACATACCGAGTCTTGCACCTACGCGAAAAGAAAGCGCGGTGGAA
CTTTCGACAAGGTTTGACAGCAGTTATCTTGTGGACGACTCTACATCTGAGAGCGAGGATAGTGAAGACTTTGACAGCAGAAGCAATGATACCTCATCGT
TGTTCTCGCGGCTGATCGACTCTGCTGCGCGTGAGCAGTGGGAGCTCATGGATGTTGGTCGTTTGGTACGGCTGTTTGCTACTGAATGGAGCTTCAAACA
GAGTAATACTGCGGACTTCCTGCTCAAGACGTGCCCCGAGTTGGTGAGTGTAGACTTCCTAGAAGGATTAGGCATAAATTTGTCGGCGAAACAACTTGTC
CGAGTCTTTGAGGAAGGATCGGGCAACTCTGGGGTGTTGATGAACAAGATGGCATCTGCTGTGGAGAATGGGCATCTGAGTGTGCGCGACCCGTCATTTG
TGTCAGCACTTGAGAACAGTGTCGCACTCATGGAGACAAACATTGAGGTATTGGAGCTGCTACATCCATTGCTGGAGAGCCTGTCAACGGTGCGTGATGT
GGGCTGTCTGCTTAAGCAGCTATGCGAGCACTGGCAGCTAGAGCGCACGGTTGCGTTAGTGCAGCAAATTCTTTTGTCGAGCGTCTTCGATGATCTGGAT
GGCAACCAGGACGAAATTTTGATTGACTTGCCACATCTCAAGGGCCGATTAGACTTCCCAAGTCGTTTGGACCAggacgatgtggacgaaAATGGCAACT
TAGCAGGTTTTCTTGCTAACGATGATAGCGATTTCAGTGGAGAAGAGGGGTCAGAAGAGGAACCAGACGAAATTGacagcgaagatgatgacgatcATTA
CGATGGTGAGTCGGATTCCGAGGAAGAGATCGAAATTACTGGTCGGTCTCGAGCACGAAGCCAATttattgaagacgaagccgacgtgggtgaagaagac
gatgaggaggaagaggaggaagaggcggaagaggaggaagagctaAAAGAAGCTCGCGGTAGGGGGGATGatgcatcgtcttcatcagaTAGTGATTGAT
AGGTTAGCAGAAGCGAAGCAccatttgctgcaaacttGAATGCGACGTAGGAGAGATAGACATAGTACACGTAGCGCTACCAAACAGCTTATTGACAATC
ATTGGTGGCTAACTCTACGATAGTAGCTTGATAAAACTGCCCTCAGCTGGGGCTACGGTAGCACTGACGTCCAGCAATTTGACTGTATCTTTTACGAATA
CCAATCTAGCTAAGTCGAAAGCAAAGCGTTGAGAACAGCCAGAACGGCGAACAGCAACGCGACCCAGATGTAAGGAACCATGCCATTGCTACCTTCTCGG
CTGCCCTTGGACACCTTTTTCGAGTGCGCAATCGCGGCTGCGTATTTAGGTAATCAGCACGTAATTGTCAGTGCCGACTATGATGAACTCCGTCCCATCT
TAATATCATCTGCGATAACGTACCggcacgtgctgctgcagatatcTCCTGAAACTCTTCGTCATTAGCAGCCTTGCCTCGACGCACACCCTTCTTTGAC
AAGGATGACGCTATCTTATCTTCAACAGGCTCTTCAGTATCAATTCCTTGCTCGAATATTTGCTGGGCAGTGAGGCCGTTATTGTTGACTTCGGCTAGCA
AGTCCGGGAATGCAGTAGTCAGCGCCTCCGCTGCTGTCGTGGGCCAGCTAGCTGTAGGGTCACAGTGCATCGCCTCCGAGTGCAGAGGTGTGCTTCCGTG
GCTGTTCTTAACAGGTTTTGCACCCTGCTTGCGGTAATGAACAACGGGAGGTGAGAACTCTTGCTACTGGTTAGGTTGGTACTACCCACTGTGCAGCACA
CAGTATGACAAGCCGCACCTTTGCGATCAAGAAACTAATCAGTGCCAACTGATCATCTCCATTCTTGATGCAAGCCCAGTGGCTATAATCAATGCAAACA
ACAACGTTTTTCTGCCCATGAGGATCGcccaacagctccagcaaaaactCTATAGTATAAATGCACGTACAGTGGGGCATTGCCCTTGACGTCCACCGGG
TTCACATTGGCACGACCCGTTTCCACCAGCAATTGAACGATTTCGAGGTTCCCTTTGCCGACCGCGACATGAAGCGCCGTCATCTTTTTGCCGTCAACTG
CATCCACCTTGGCTCTGGCTttcagcagtagctgcagcgaCTCCGCTTCCTCGTACTCTGCTGCCAGATGAAGGATCGTTTGGCCTGATGAATCCTGCAC
ACTTAGGTCCGGTTTGCCCTTCAGTAGAGCCTGGAAAATCTCTTCAAAGCTTGGCGGCTGCTGTGCCAGGGCCAGCATGAGCGGCGTGAAtcgacgcttc
ttctcctgcaggTTGAGCATGGCACCATTGGCTACGAGATGCTGCACGATCTCCAGCTGGTCTTCGGCCACAGCCACATGCAGTACTATAAGAAAGCGAT
AATGAAAATCCGCATACCATTTTAGTCAATTGGTTCTACAACATACACATTCAGTCAAATTTTTAGGACTGCACATACCAgacttgcccttcttgttCTG
GAACGACCAATCGCTGCGCAACTCGATTACCTTCTCCAAGTCGCCATTCCCTGTCATATAACGCTGTCGGTTAGTCGAGGGCGTGGACGAGAAGTCTGTA
ATGCTTACCGGCAGCACGGAGCAGCTTCGCCATG