Description :
From Genome Similarity Track
Location :
Scaffold_194:104713- 110279
Sequence
5566 bases(100 bases per row)
GTACCGCTTGAGTCGCCCGACGTAAAACGTCGGGGGGGGTCTAAGTGACGACGGGATGTCCAAGGTGTAGGCGTCGCCCACAGCCTTGGTTACACGAAAA
GGACCGATGAAGCGTGGGGCAAGTTTGTTGGCGCCGAGGTTGGTCACGGCGGAAGCGCGGATTCCCTCGGTCGATAGGAGAACGCGATCTCCTATCTTGA
ATACATTCACGTTCTTTCGACCGTGCTTATCAGCTTGTTCCTTTTGCTTGTCCACTGCGTTCTGCAGTGCGTCGCGTACGAACCTTGCGATGGATTGCCT
TTGCATGACGAATTCCGCAACTGCCGAGCGATCGGCAGGAAGCACCGAGGGTTTCGGTGTATAGTTTGCTGTGTAACTTCTTGCTCACGAGTCTTGCTGC
CTGGATCGATCAAGTTCTCCGACGTCCATCTCGTTATCGGAGATGCAGTATGCCGAGGAGGCTCGATGGACTGCTTGGACGGAGAACGAGTCAGGGCGTT
CGCACTGGCTACACCCGAAGATAACCCTGAAGTCGAGTGCGCCGGCAGGCTTGTTGACACCGGTGAGGCTACCAGTGCGTGCTGAGACACCGGTTCACGT
ACCGGTGATGACCACGACACGGACACGTTGTCCCTAGAGCTGAGCGCAGCTTCAGCATCCATGTCGACCGAAGGAGGTTCTCCCCCACCAAGGGTGGAGC
CGCCAGCATCCGTGGGGTGACCCACGGCGAGAAGTGCCGGAACACGTGGGTGGCGAGCGTTGTTCACGAAGAACGGCGTCATACCCGTCGAGGAGTGCTC
GGCGTTGTTGAGTGCGAGCTCGGCTAGCGGTAGGAACGAGCTCCAGCTCGTGTACGAAGTTGCGTAGCTTCGGAGAACGTCTTCAAGGACGCGGTTGACG
CGTTCTGTTTGTCCATCCGTCTCCGGATGTGCCGCAGTTGACATTAGCAATTTGGTTCCCAAGAGCTCGAAGAGGCGTGACCAGAACGCGGATGTAAACC
GCGGGTCGCGGTCGGACATGATAGACTCCGGCAGGCCGTGGTGACGAAAAATCACGTCGACGAAGTGGGCCGCGGACTCTTCCGCGGTGATTGAGGCCGC
CACCAGAACGAGATGGACCATCTTGCTGAAACGATCAACGAACACAAGTACACCTGTGCGCCCGGCTGTATCGGGCAGAAGACCGAAGATGAAGTCCATC
GAAAATGGATCGCCAGGCTTCCGTGGCGACCGGAAGAGGGCGCAATGGGGCCTGAGACGTCGAAGACGGTTTGACTCGCTGGCAAGTTTCACATGTGCGG
ACCCACTTGCGTACCCACTTGTACATGTGCGGCCAATAGAAGTCTCTCGACAGAGCCGCGTACGTCTTCTCGCGACCGAGATGTCCTCCAGTCGGGGCGT
CATGATACTCGTGGATTATGCGCGCACGTAGATCAGCGTCGTTTGGGACGACGACTCGAGGTCCATCGAACCTGTCGATGCTGTACTTGAGCAGATTACC
GTCCAGTCGATATCGATCGATCTGATTCCGCGTGGTCTTTGACAGGGCACTTAGCGTGTCACTACTAGGAGCACGCAGGTGCTTCATGATGGCGCCGTAT
ATAGGGTCATCATCGTACGCTGTAGCAATCTCGTCGCCCAGCGGGAGTGTGGGCGTGGTCAACGTCAAGTTGATGCCTGACGACACGCAGACCGCACATT
CGTCGTCGTCCTCATCAGCGAGCTGATGTCCTAGCGCTTCACGGGGATCGTAGTCCGGACGCCGAGACAGCGCGTCGGCGAGAATGTTATTCTTGCCCGG
CTTGTAGTGAACAGCGAAGATGTACTCGGAGAAGAATGACACCCAACGGGCCATCCGTTGCGACAAGTGAGGGCTCTTCATCGCTGTCCGCAGCGATGCG
TGATCAGTGTAAACCGCAAATGACTGTTCACCGAGCAGGTACACTCTGAATTTGATCAGAGCGTACCGCATTGCCAGGAGCTCCTTGTCGTGGACTGGGT
AATTCTTCTCGGCTGGCTTCAGTTGGCGCGACTGATAGCTGATAACGCGTTCGTGTTCGTCATCATCGAACTGCATCAGCGCACAGCCGATGGCAAAATC
GCTCGCGTCGCAGACGACGTGAAATGGCTTTGAGTCATCAGCAAGCTTCAGTATCGGCGCAGACGCCAAGCTCTTCTTCACCGAGTCGAATGCAGCTTGG
TGGTCCGATTTCCACTCCTAGATCACGTCCTTCTTCAGCAGCGAGGACAGCGGCTGGATCAATCCAGCGTAATTCTTCGTGTACTTGTGCAAGTAATTGG
CCATACCAAGCCACTGACGCAACTCAGTGGGGCTTGTCGGCGTTGGCCAAGCACAGATAGACGATACCTTCTCAGGGTCCGCGCGTACACCGTTCTTGCT
CACGTAGCATCCCAACACCGGAATCTCCGGTGCGCAGAAGACACATTTCTTCAGGTTTGCGTAGAGCTTGTTCTCTCGCATCACCTGGAAGACTTGTCTC
AGGTGTTTCAGATGTACGTCCACGGCACTGAGGTTGCCCTCAGCGCGGCTGTGCACGAAGATGTCGTCGAAGTAACTCGGCGCGAAGTCTCGAAGCGGGC
GAAGCACATGGGAGACCATGCGATTGAAGGTGGCAGGCGCGTTCTTGAGGCCCTGTGGCATCACGAGCCACTCCCAGAGCATCCCGCTCGGTGTACTTAC
GGCGGTGAGAGGTACATCAGATGTTCTCATCAGGATCTGATAGAATCCATCGGTCAGGTCGATGGCGCTGTAGATGACGCTGCCAGCCATGGAGTCCAGT
ACCATATCCTTCCGAGGGATCGGAGTCTGCGCGGGGATGGTGGCATCATTCAACTTGTTGAATGCATGAACGATACGCCATCCCCCTGTGGCTTTCTTCA
CACAGAACGTTGGACTGGAATGGGGAGAGGTACTCTCACGCACGTGACCCGCCTTTCGGCGGCCCTCGAAGAAGTCATCGATCGCTTTCACTTGATCACG
CGGAAGTGGCCATTGTCTGGTAACGCAGTACTTCGTACCTGGCGCGAGGTCGATCTCATGCTGAACTCCACGATCCGCCGGTAGCTCGGCGGGGATCTCA
TCCGGGAAGACGTCGGCGTACTCGCAGGCGGTGTCGTATACGGGATTCGCTGACTCCCGCAAGGCCTCCCAAGACTGCGTTTGGAATCGTTCCTCTCGAG
CAGACTTAGGTTCAGCACCTAGCGGACGTGAGCGTACACTGTCCGTTGCGACCGCATTTGCTGCCTCATCCACCGAGACTGCCTCGGTGACCAAACATAC
TTGCTCGACGTCTCCAGCCTTGAGGTCCCGAAGAAAGTTCTTCCAGGACAAGCCTGGAAGGCGTGTGATCGCCGCCGCTTCGCGCGGCGGGCTCGCGATT
GCGATGCTGCGCGACCGATTCGGGCCTCCTTCCACGTACTCCAGCGCGCTGACCGATTCCATCGGCGGGCTATCGCTGGTCGTGTAGTCTCGACGAGGTT
TAAGGCGTCGTCGCTTCGACTTCTTCTTCGACTTCCTCGAGCTTACGCTCGAGTCTGACGCACTGCTACTCGACGATGCATCACCCTCCTCTAGGCGCGG
GAGACCGTACTCGACCGGGCCGGGAACACGCGGGAGCCCCTGCTCTACCGCGGCATCGTTTGACGGGAGCCCAATGTGCTCGACCGCCGAATCGTTCGGC
GGTAACCTCTGCTCTACCGCCGTCTCGTTGTGTGGGAGCCCCTGCTCGACCACTGTCTCGTGTTGTGGGAGCCCCTGCTCGACCATCATCTCGTGTTGTG
GGAGCCCCTGCTCGACCACCGTCTTGTACTGTGGGAGCCGCTGCTCAACCACCTCATCATCTACCTCGCGAAACCGCGAGGGCTCTTCGTCCAACAACGT
AGCACAAGCCATGCAGAGAGGGCCATCGCTCGCTCTGTGCACTGCTTGTGTTGTTGCTGTTTTGTCTACCACTGTGACGTGGGGCCAGTCTCTTGGCGCT
ATCAAGAGGTGTGTGAAGACTCGCTCACGTCGAATTCACGTCGACGCTTGACTGATTGGGCCAGCCAGTCAATCTCTGGCTGATATCGCGCAAGCCAAGG
GATGCCCAGGATGCAGTCAAACGCGTAGTTCATCTCGATCACCAAGAAGTCGTCCTTGCTACGGAAGCCGTCGAACGTGTACGACAAAGACACGTCACGC
CGCGCAACGCGGCGAGCCTTATTGTCTGCGAGTTTGACTTGGATCTCGCCCGGACCATTCCGGACGCGGACGTTCTTGGGTAGTACCGACAAACACGACG
CGCGAAAGAAGTTGTTGGTCGCTCCTGAGTCAAGGAGCGCGCGCAGTGGTCGCCGGGCACCGGTGACGTGGAGGCTGACGATGATCAGTCTCGAGTCGCC
CGGCGTAGTGGTAGCATTGGTGTGTGCTTGGAGCACGGGAGGGCTCGAAGGTTGGGCTGCCACCGGAGGGCCCGGTCCTTTGTCAAAGCCAGTAGGGCGC
CCCGCACCTACTGGTCCTGGTCTTTTTTGAATGAGCGACCGAGGAGTGTTCCGCGTCGACGTGAGAGACGACGGGAGCTGGCGCGCGGCACTCCGCCGCG
CGATGACCCTTCTTCCCACAACGGAAGCAAATGAGGGAGCGATTGCTTCGTCCAGAGCTGCCGCGGTAGGACCCGCGACGTCGATTGCTCGACGCGCTGA
TGGCGTCGATCTCCATGGGCTCGGGGGTAGACTCCCGGGCTTCCGCAGGTATGGCTGCGGCGTACGATGCAGCGACCATGTAATCCTCGCGAATCGCGAG
TGCAAACGCCTCCTCGAGAGAGGAGGGCTCAGCTCTAGTGAGGCAGTAGCGGGTCATACCCTCGCGCATGCCGAACACAAATACGTGGACTTGCGAGGCC
GTGTCGATTGGCTTGGTCACGATGCATGACGCCAGGTGTCGCGTCTTCTGGACGTAATCACGCATGGACATCTGCCCTTGCCGCAGAGCGAAGAACTCTG
CGCGAACGCGAGACTCATCTTGCGGGGGCTCGAACGCGAGGCGCAAGTCGCTCTGGAGCGTTTCCAGAGTCGGGAAAGCCTCGGGGTCGACAACCAGCTT
CCCGAGGGCCCATTCTTTGGCCTTCCCGGTTAACCGGGAGAGGAGGAAGTTCATCTTGGCCGATGACGCCTCGATGCGTCGCGAGGCGATAGCGATGTTG
ATGCGCGGAACCACCGATTTAGCGGAAGCCGGTTTTCACCGGCGCCAGAATACGTAGACGTCTCCATCTTGACGACGTCATTCTGGGATGGACGCGAGGG
AGTTGACACCCGCCGATTCGCATCGGCGAGCTCGCGTTCCATGAACTTTCGTGCTGCAAGACGTTGCTGGTCGGGCGTCGCTGAGCTCAGCAGCGATGCG
ACGACAGCGTCTCCGGACACCGCCACGAGGCGGTGAAGCGCTTCCCACTCCACGCGAGTGAGATGGGGGAATGCAGCATGCTCCAGGGTCGCCCCGGAGA
TCTGGACTTGGCTCATCGTAGACTTGGTCGTTGGAAGGACTACTAAGTGCTACCAGATGTAACGGG