Description :
From Genome Similarity Track
Location :
Scaffold_398:10470- 15498
Transcript NameFunction/comments
Hyaar_Emoy2814016DEAD/DEAH box RNA helicase putative
Hyaar_Emoy2814017hypothetical protein
Hyaar_Emoy2814018PREDICTED: gem-associated protein 2-like
Hyaar_Emoy2814019PREDICTED: UPF0598 protein C8orf82 homolog isoform X1

Sequence
5028 bases(100 bases per row)
GAAGACAGCTCGGAAGAGACAGAACATTCTGGTATCCGCCACCATCAACAGCGGGGTGCAGCAGCTTGCCATGTTGAGTCTGTCGAGCCCTGTGCTGATC
GATGTCGATGCAACTAACAGCGATGAAGACGCACTATCAGAGACCAAAGGGTCTGGTCAGGAGAAGTTTTCGACTCCACATCAACTCATGCAGCACTTCA
TGCTCGTTCCAGCAAAGGCGCGCTTGTGTGCACTGACGTGCTTCTTACGTGAGGAGTTGCGAAACGCTCCTCGCGATGACAAGAATGGTAGGCCTAGCAA
GTGTAAAGTCGTAGTATTCTTGTCCACGTGTGATGCTGTGGACTTTCACTACACGCTGTTCCGCAAGTGCGCGTGGCCGTCAGGAAAGGGGTCACCTGGA
AACGACGACACAGCAGGCGAACAGAATGGTGTGGCCTCCCTGTTTGGTAATCAAGGACCCGTGTTCCGCCTGCATGGTAACATCCCGCAGCAAGAGCGCG
TCACCACGTTCAAGAGTTTCTGCTCTTCAAGTTCCGGCGTGCTTCTCTGTACCGATGTGGCTGCCCGTGGTCTGAACTTGCCTACGGTGAAGTGGATCGT
TCAATACGATCCGCCCACTGAGACCCGTGACTACGTCCATCGTGTTGGTCGAACTGCCCGAAGTGGCAACCAAGGCAGCAGCCTGTTGTTCTTGATGCCT
TCTGAATCGGAATACCTTGACTACTTGAGCAAACAAGGCCTGAAGTTGAATGCTCTTAGTCTTGAAAAGACCGTTGCCCGCGTTAGTAAACATGGTGGAT
TCTCGACAACATCTCGGAAAAAGTTGCTGCACGAGGTTGTGCAAGGAGACTTGCAATTCTTGTACGAACAGACGCTCCTGGCAGACAAGGAATTATTCGA
GCTGGCGTGTCAAGCATTCCACTCTTTCGTGCGCAGCTATGCCACGCACTCGTCGGACACAAGGCAGATCTTCCATGTCCGGAGTCTGCACTTTGGTCAT
GTTGCGAAGAGTTTTGCGCTGCGGGAGCCACCCGCTTCTTCGAAGCTGCGCGCGACTGGGCGAAATGCCAAGAAAGGTACGCTGCAAAAGCGCAAAGACC
GTGATGAAAAGCAACATGCAGTGGTCGTCAAAAAGCAGAAGAAGGTGCGCGACGAGAAGCGTCGGTACGCGCAGTATGTGTCCGAGTTCGCCGACTAGTA
GCCGTCGGTCGAACCAACCTGCAATAAAAATAACTTGAGAACACTGCGTGTTTTCCGCTTGACTTGTCGCGAGGAGATAATCATGTTATCGTACATCGAT
CACATCAAGTGCGTTTTCTCTTTATTAGCTTCTGCTGCTTGTTGTTGTCGGTCCTGACAAGTTTCCGCTCTACCACAGCCTTTGCCATTTTCTTGTCCTT
CTCAACAGTAGGAGCCAGCAGCAGTAGCGGCGCAAAAACCTCTGCGACATCCGTATCCTCAGCAATCTCGACAACCTTGCCATCAAGAGCAATCGGCAGT
CGAGGAAAAGCACTACAATAGTCAATCAAATACATCACCTCATGAGTAATTAACAGCAACAATTCCGCAGACGACCAACAACAATCAAAGCGCACAACTT
GCACGTGGCTTACCGGAGTAGCGTCTGCAGTGCAAAAGCAGCACTGAAACATCGCTGAGCAACCATGACGTCATCAGCCGCGTAGCCATTAGCGTGCAAA
AAGTACTGCACCACTTTCTGTGACACAAGGGGGTTCTCCAGCTGCAACTCCATGAATCGCGCGAGCTCGTGCACCACCGCGTCGCGTTCGTGCATCCACT
GGACTTTTTGCAGCGCAAAGACACGATTGGCCACGTCAAACGTGCCAATCACCTGCGGCTCCCAGTACTCGCCATCATCTTCTCCCTCTTGGTCAGTCTT
TTCCTCGTCCTCTTGATGCGTTGTACTCAAAGTCCTGTCTCGACCGTCAATCGGTTGACTCTGATACACAAGCTCCACGAGCGTTTGCCGCTGCTCCTCT
GTCTTACAGAGCGACAAGAACAAGTCGAGACCGTACGTCACACCTTTTGGAAGCACTTGAGGACGAATTGTTGGCGCTAGCGCCGTCACGACGCCTTGAA
GGTCCTGTACAGCCGTTAGCGGGTCATTTGCCATGATGTGATGATGAAGACGAGATTTGTGCTGTATTTACAAGTGGTGGAGGTGCTGGCGCTTCAAATA
TACTTTTTAGGAAAGAGAAACCCAAAATAGCGTTCTGCTCATGCAGAAACATTATTATTTAAAACACTGGAGTTGCCCTAAATTTGCGCGAATTGGGTAA
GCATGATGGCAACAGCGCTGCCCGTACAGGGCGCACAGACAGTAAATGTGCAGCTAGTTCGGCAGCGAATGCACCAGGGTCTTCCACCACAGGATGTGCA
GGAATATCTATGGCGAGTACGACTCGAAGCTGAAGCTATTCCCGACTTCGTCGTAGCTTCCGATGTCGACCCAAGACAATTCGATGCCCAGCAGACCAGG
AATATGCCAACCTTGCAGTCATTTGGAGTCAAATCGACGGCGACCGATCGAATTCCTGACGACTGGTGGACGCGAGATTTGCTAGCAGATTTCGCCGAAT
TGAGGCAATTGATTGCGCGTTGGGAAAGTATTGGGCCACCTCGAACGGAGACCAATAGGGCAGGAAACGGTTCGAATGAGTCTGTTCGCACGAATGTACC
CAAAATGAGCGACGAAGATGGATGGGTGCTCTTTTTCTTTGGGAAATCAGGGTTTGAGACGTTGGCGACACCGCCACATCTGAGACTGTTGCTGCAGTTC
GACCAGGTGCTGACCAGGAAGTTGCTGGATTATCATGCTGCGTGGCTCAGTGAGGAGATGACGTCGCTCTCACGAGCACGTGCAGTATGGATGTATGCCT
TGATGGCTCGTCTGGACAAGCCAGTTCATGCTGCTGTAGCGGCTACAATTCGGCAGATCCTACGACGCTGTTGGACCTTGAGGTGCGAGCTGGAAACGCC
GTCAGAGGTTCAACTCAAGTCGCTCAACGTTCTAATTGTGATTACTGGGGATTTCTTTGGCCAATTGCACGATTTGGAGTAGCATGGTGATTACAGCAAT
ATGAAAATTGATGCGAATGCCTGTTCTGATGACTTTCTGCAATAGCGGTAGTTCAGCACCATCAGCTTGGCCCTGTCCTACACTATCGGTTCGATGCGCC
TCTTGACGGTCAACTACTTTTGTAAGTGTTATTAAAGATCGAAGAGTGTCTGATCGTGTTGAACGCAATGACATGAAAAACTAGACTGGTTAGGATGACG
AGCTGAAGACATGTAATGGAGGGTGTGCATCGATGAACTTTTTATACCGCCACTGCCCAATAGTTCACGCAGTAGAAGGGAGGCTGGTATTGGATACTCC
GATACCAAAGTGATGGAAAACGGAGCGTAGTACGGCGATGTTATATGCGCCGGGTGTATCTCTTCACTCGAAACAAACATAGAACAGTACATGGCAGCAA
TTGGCTTTCCTTTCTATCAAGATGAAACCCAGAAAGCTGTAACATCATTTGTGCTTGGCGTGTTCCGTGTCAGGTGGACTGCTTCAGGAAACTATTATTC
TCATAAGTGTATCACGCAACAGCCTGTCGACATCGACCTAAAGACGATCACTTTTGCTCCTGTTACCAAGAATTCAGCTACATATAAAATAAGTCATATT
GCCTCCTGTCCGTGCCGACACAGACATACTGACAAAGGTCGTTGCGACAGGAAAGCGCCCTCACTCTAGTGACAGTCTCCTCAAAAGCCGATTACCTGGA
GAATTCGATCCCTGATTCACGACACGAATCGTGCGGTACTCGGCAAAATGACGGTAGCCTTGTGCCGGACGTGGACATCTCTGTCTACTACTTGGCAGCG
TTCCTATATTGGACTGCGCAGGGTTTGTACCGCCAATGTGGACAAGTACCTCGAACTGGAGCAGCTAAAAACCATAAAAAGGTCAGAGACTAGCATTTTG
TTGTGATGTGGTTTGGCCATGTCAAATTTGATTCGAGGCATTTGTGGTCCTATAGTGAAGCATTTTACGAGCGACAAGGTCAGCTTCGGCGATACTTTTA
CTACATTGATTTACAGGTTTTGTCGATAGTAGCATAGCTGTGTGTATTGCTAAAAATTGAAGTGTCTACAGCTGAATGATGACAAGACCTTTTTGCCGCT
GTATTGACTAGGGCCGTCTGTTTACGGAAGACACTCGGCCAAAGAACATTGCGACGTGTCTCAAGAGCGCCAAGTTCTTGCGGTTCTTCTTCTCGCAAGT
GCGATCAAATGACATTGCACGCTGCAAGTCGAAAGAAGAAGAGAAGTTGTTGGAGTATCCCTTTCAGTCCCCATGTGGCAAAGAGATGAACTACATCAAG
TGTGCTGATCGCCCGTTCGTGTTTGAGGACTTCCAGCGAGATGAATGGGGAAAGTGGACGCTCATGTTTGGGGGTGGAGGACTGACGATGCCATTTATGC
CCGAAACGATACGCATCTCCCTTTCAACGGGAAGACTGTACCACGACGTACGGACTAAACACGTAGCGTCTGGCACTCCTGAAAGCATCGCACTTGTAAA
GTCTCAACTCGCCGTCGAGCTCAGCAAATACATTGACATGCACAGCTTTCCCGATAATATCGACTCTGTCGAGGATGTAAATGCGTTGAAACTAGGCGAC
TTCAAGTGGGAGACTCAGCGCTATGCCATCCACGCCATACCGTAAGGAAGTTTTTTACCGCTGTAGGTTAACTGATAAGTAGGAAGTATAGCCAACTACA
GCACGTTGGTCTCTGATCCTCAAGACACAATTCGATAATTTCCGACCATGACGTTGCGTAACAGTCGCCTCGTTCACCGACAAGAAGGTGGTTTATTTTA
TCGTGACCAATTGTGGCCGTCTTCAGCGTCCATACCAGCACGTTGTCCAACGCAATAGTAGCCTTCTCTCCATCACGTGTGGAATCGTCGTCGTTGGTTT
AAAGTACTCTCGTCTTAACGAAGACTGG