Description :
From Genome Similarity Track
Location :
Scaffold_727:1047- 4450
Sequence
3403 bases(100 bases per row)
GCTAACCAAGTTAAGAGGAAGAGAAGAGAAAGAGAAGAGTGAAGATGGTCAAGGGATCAGCAACTCCGAGCGACGGAAGCCCAGCGACGGCTGGAGGATC
GCCTCTTGTGGGGTCGGACCCGGCGGATCAACGACTCATCGCCATGACGATGGAGGTGGGACGAACCGTCCAGTTCGACGAGGATGGCCAAGACCAGCAG
AGCGAGAGCAGAGATGCAAGTGAAGGAGAGTATGAAGAGAAGGCCGAGACCGCTGAGCTCGGAGAAACGAAGACTACCGCCGAGCTACTTGGCGAGGTGG
AAGAGTTGACGCTGCAGGTGGGACGCATGGGAGCCCCACGTCCTGTCGAGCGCAATTTATCCGCCGAGCTCGACGAAGGTGCGGACGATGAAGAAGATGA
AGAAGACCATGGCGTTGCTCAAGGGGACCGTCCGCCCCTTATTCCAAAAGCGACGAGGAACGCCGATACGCCGAGCGCCAATAAAGTGTTGGCTCGACTC
GGCGAGGAGATGAGAACGAGATCGGAATGGATGATGATGTTCGCGCCTGTGGCGATGGCGCAGGCGAAGTGGCCGATGTTGGGTCCCGAGTTAACTCAGC
CGGTGCGTGCAGCCAACATCAATCAGTTGGTGGAAGAAACTGTGTTGCTGTTGAAGGCGATGGGCTATCGGTGCAACAGCCGACCAAACAGCCTCATTCT
GTCCGACTGGAGTCTGACCCGTGGCGGAGCCGAGCTCTGGCAATGGAAATCAGAAGCTGAGAGTGGCGTTTGGATTGGAGAAGGCCCCTGGTGGAACGAA
GAAGGTGTACGGCCGAGTAGCCGAGTTCAGACCGCTCGGCGAGGACCCGAGCAAGATTCCTTTGCCAAAGACCCCGGAGACGAAGAGACGGGAAGTGTTC
CGCGCTACGCAAGGGACTCCGTACTTCGAAGACTCCCACATGCTGACTCCACTGAAGCTAAACCCGACTCAGCGAGCGCCGAGTCGTGGGCAGCGGAATG
TAGGTCGTTACCGTGAATTGTATGACGCTGCAGATGAGGCTGAGGCTTACGAGGAGGATGAAGAAGACGACAACGCCTTCGACGTGAGAGGTAACCATGA
AGAAACCGTGAAGGACTACATCCGAAACTTGAGCTTTGACGCGGCTGAAGAGGACTCGACGCAGTACCTAGAAGTCCGAACCCACGCCTCGCTCGACAAA
ATCGCCGAGTTCGAAGGAAAGCGCTACCGCTCTGACACGTCGCTCCAGTGGCTCAAGCGTTTCATCTACGAGATGAAGAGCACCAGGATGCCCCAAAGTG
CATGGTGCGAGCCTTTCTCGCTATGCTTGGGACGTGCGGCGAAGAGTTGGTACAGACAGCTGCCGAAGAAGACTCAGCGACGTTGGAAACTACTCAGCGA
GGCGTTCCTGGATTATTATTGCTCACAGTTCGACCAATCCGCCCGCACTCGTTACTACTCGGCGAGACGTAAAGTCAACGAACCGATCTGCGACTTCCTG
ATCCGACTCAACGGGTATGCTCGGACAGCCAAGATCCAGTACGAGAAGTGTGGCGCCGACGCAGCTGACCATGTCGAGCACTTCTTGATGCATTGTGGTG
ATGACGATGTGATGGATTTGATGTACCCCTTGCAGTTGGAAGACATCAGTAAGGTGGAACAGATAATCAATCGTCGGATCCTCGGCGAGAAGCGCAAGAA
GCAACGCGACCGACTCGTGATCGCACGAGGCCGAGATGACAAGCGGAAGGATCAGAGCCGCCGAGATGAGAAGCGCAGTCGCAAGGAAGAAAACCGCGAC
CGCCGAGTCACTGTCGTTGACGCTGACTCCGACGGAGAGGAGCTCATCGATCAGAACCCGCCGAGTCCGTACAACTCCGAAGACGAATGGGATGATGAGG
ACCAGTCCGGAGGACACGACTCAGCGGAAGACGACGACTACATTGACGCCGGTGTTTCCAATGATAAAGGAAATACACCGGACCGCCGAGAGAACTCGAC
GGGAGACCAGAAAGGCTCGAACCGAAGCTGGGGAAACTCAGCGAACCGACCTCCGCGACCGTACAACCAACGAGAACAGTCGAATCGTGGAGATGGATCA
CGCGACAACACCCAACGTGGACCTTGTGCAGCTTGTGGAAGAATGGGGCACTCGGCTCACTACTGTCGACGACGCTGCAAATTCTGCAGACAAGTCCATG
AAGGCGGCCAGAGCGAGCTGTTTCGTCAATATGAGAAGCTGGCTGCGTTCGTGAAGAACTCTGTCGACAAGTCGCAAGTGCCAGAAGACCTGCAAAACCT
TTACGCGCCGAGTGATTTAAACTCGGCGGCCCGCCAACACTGACTGGGTTGGAATATGCCGGGCTGCCACAGTCAGCTGAACCTGCCGTTAAGGTAAACT
TCTTGTTTGCCTTCGTAGGCGAAGCAGGACGGCCCGAGGGAAGAAGCGGGGATGGCAATTGGATGTGTGAAATCGACGGAATTGAACGTGAGCTCGGTGA
GTTAGAGGATAACAACCGAGCGATTGCAAGTGTAACTCGGCAGTCAGACCAGGCTGTGCATCGTACCAGAATCATGAAGCTGCTTCCGGGAGAACGGCTG
GGATGGTGGTCAGCACAGACGTTCGATCGCCGAGTTAGAATGAGAGCCCTCGTATTGGGTGCAGTGAACGACCGAAGGACCAATATATTATTGGATACCG
GAGCAAATGTCTCGGCGATTAGTGAGTACTTCGCGAGGAAACTGCGTCTCAAGAGAGTGGCCAGCAGAGATAAGCGAATCGACATACAAGGAATAAGTAA
AGACAGAATGGTGACAACGTCAAGAGCAGTGGTGAAGGTGACACTCGGCTGGGAAGTGGCATACGAGTTTGAAGTATGGATAATGTCTCATCATGCCGGA
GTCGATTTGATTCTGGGCACCGACTTCATGATCCCAGCTGGAATCCGTCTGGATCTGTACAACTCGGCGGTCAAGCTACCCGATGAGATGGTGATCCCAC
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN