Description :
From Genome Similarity Track
Location :
contig_2:1046847- 1050338
Transcript NameFunction/comments
g815.t1hypothetical protein
g816.t1RAW38994.1 hypothetical protein PC110_g4754 [Phytophthora cactorum

Sequence
3491 bases(100 bases per row)
CCAGACGCGGCTGGAGAAGATGGAGGCCACGCTCGCAGGCACCAACAAGGCGCGGCGTCTCCACGACGACGCAGAAGCGGCTACAAGATGACGTTCAGGA
GCTGCGCGACGAGCGCAACACGTGGCGGCTGTTGTTTGAGCTGCGCCAGGTGTGCCACACTAGTAAGGACATGGCGGACGGCGAGGACAGTTTGATGATG
CTGGGCGCGGAGACGGAGGAGCTCCGGTTCGAGATGCTGGAGGACGACGCGGTGCGTCTGCTGGAAACGCGCAACGAGACGTACAAAATTCAACGGGCGG
TCAAGGCCTGGCTGGAGAGCATGGCGCTGGAGACACTATCAGTATCAGTGACAAGCGCGGTGCCGGTGGATCGCGCACCCTCAGGATGATGCGCAAACAG
GGGTTCCCAGTAGACGATGATGTCCATATGGACCCTGATGCGGTGCTGCGCGACGGCGACGACCACATCCTGCCCGATGACACGGAGGATGAGGCCGAAC
TCATGAAGGCGGTGTGGTTGTATGTCCGTGCTGGACGCATGGACGACGCAATTGATCTGTGCATTCGTTTAGGTCAGTCGTGGAGAGCTGCAAGTCTCTC
GGGAGGCAACCCCGTCGGTGCAAGCGAGAGCAACGAGCGTGAGGATTTGTCACTGGAGCGATGGGGAAACCCGTTCCGTGCGCTTTGGAAATCAATGTGC
TGGCGGTTGTCGGAGCAAGCTGTTGATGGAAAGCTGTCGAAGAGCAGCAGCTTGCTTGCGAAGAAGTATGAAGAGCTTATTTATGCGGCCTTGAGTGGTA
ACATCCAGGTCATTACCAAGAGCTCGTTGTGTGAGAGCTGGGAGGACCACTGCTGGGCCTATCTGCAAGGTATTACGGAGCAGCAGCTCGACGAAATATT
GTTCAAGCTGCTCAAGGTGAAGGTTCAGTCATCGCGGTTGATTGTCGGCAACAACGCTCACTATTTACGTCATTACTCGACTTTGTTGGACAAGACGAAG
TACTTAAAGCGCTACCAGGTGGACCTGGACACGCTTGTTCGATGAGCTGCGCGGAAGCCAAAGCGAGCATGTCCGCATCCAGGCCAACCAGCCTCACCGT
CAGATCCAAGCCAAGTTGGTGACTGCCAAGTTTGATTACATCGTGTCTCGCATTTTGGACACGCTACTATTCAACCCGGAGGACGATTCATACAATTGGG
ATCTCAAGCTGGACTCTGCTGTTCAGTCAGACGGCACTTCCTCGCTGTTTTTGCGCTTTGCCGCTCACTTCATAATGTTCGCTGGCTTCACTGGCGAGCA
TTTTGACGAGCAGGCGGGCCACATGATTTTGAAGCTGTATATTCGTCACTTGGTGCAACACCGCCAGTTGCAGTTCGTGCCGATTTACGCGTCTCGACTA
CCTGTAGCAGGCGCGATCGAGATCTACGTGCAAATGCTTTCTACGGTTGATGACAGCTTGGAACGCGAGTTGTGCATTAAGCGAATCCTGGAATACGCTG
GAATGGATGTACTGTCAGCGGTGCTACAGTCTGTGGTCGAGCGTCTGTGCGAAGAGTACCGGTCGGTAGCGCTAGGAGAGCAACAGAAGAAGGGCCAGCC
GGTGCCATCAGACGTACCCACTTCAGAATTGACAGGAGGCGGATCCGGGCAATCGAGTTCTTGTGCTTTCACCCCGAGCACAGAGCGGAGGCGTTGGTTC
GTTCTAACTTGCTCACTCGACAATTTCTTCTGGAGGGGAAGTTCGCTGCTGTAAAGGAGCTGGTCGAAGAAAACTTGCCAGAAGACTCCATCGGCGTGCT
TGACATGCATCGTGCCGCGCAATTGCTGCGCGACGACGACGAAATTGAGCAGGCCATGCGCGAGTACCTCTGTTGGCGCGCATACATTCAGGCGTGCGCA
CAGTACGATCTGTGGAGAAACTGCATCAACAACCCTGGCGCCGAGGCGCTGTCGCTGTATAGTGAGGAGAAGGACTACCTGGCAGATCTGATGTTCCACG
TGTCGCGGTCAACTGCAGCCACGCTGGAGGTCCTGCACTTTGAGAACGGGTGGCTCATGGGTTGCTCCAACGATGCAACAGAGGACGCGGCCATACGGGA
GCGTTGCTTGCCGTCGCTGGTCTTCAATTTGCACTTCATTCAGCTTGAGTCGGCCAAGACAATTATGCGTCTGAACCATTACCCGGAGGACGCCAAGGCC
GAGCTGGCACGACCGCTTCTCGAGAAGTCAATTGAGGTCGCCGATGTCGTGGCCGACGAGCACTACGCAGTGTATAACGCGCTGGACCAGGACCAATGCC
GAGACCTGCTGCATGGTTTCCGTGAGAGTGCTGTTTCGCTGGCGTTCGTTGAAAGTATGCCAACCCCGACGATTTCTCCCGACTCCGATCAAGAATAAGC
GCGAACAAGCAACTACCTGTGACAATTAGAGAGATGAAATCGACAGTGAGGAAGCAGACTCTATCTCGTGGTTTTGTTGGCTGTGTTGTTTTTTATCGAT
GGTTTGTTTGGAAAGTGTTGTGATGACCTGGTTGACTTTGTGCCAGTAGGAATGACGTTGCTCTGGTGGTTACGGGTGAACAGGGGCAGCAGCCTTGCTG
TAAGCTCCCCCAGAACTGATAGCGCCAACAATGTACTCTTCAAACAGAGTTTTCTTGCGGTCTGCGCTGTCGATGTGGTCTTCGAGCATTTTGTGCGGCA
CTCGCCAAACCTGCGGACATGGCAACCCGGGCTGGTTCCATGTCCACGCGTGTTGGTCACGGCTGTCGCCATTGTTTTTCTTTACCAGCAGCACGTTTTG
AATCCCAAAGTCTCGAGAAACTGCTTCCAGCCGAACATCGTACGCACCGCTATCAGTCAGAACACGGCCGTCGGGGACAAACGGGGCTGGACGGGTTTCA
GATATGCCTACCACCCCGGTAAGGTCGGTTAGAACGCTGTTTGTGTAGGCTCCTCTGAGCTGGAGCACGCTGGTCCCCGATGGAGCCATGAAGAAGCGCA
CATTCGATTCACGATATTCACCAAACCACGAAGAGCAACGCGTCGTAGTGTGGAAACAAACGCCGTCAATCGTCACGTAGGGGTCAGAGGCACTAACGGG
GCGGATACTTATGTCGATCTGAACCAGCTTTTCGCCAGTTGCAAGAGGAACGCAGTGCACTTGGTAGGGGCTGCCAATCTCCAGGAAAGTCGCGTGGAGT
TGATTCACTAGCTCGTCGAACATCTGCGCACTCTCGAAAGACTGCACGGACGTCACTGAACCGCCTTGTATGCCAACCAAAATCCCAAGAGGTGACGCTG
GCGGGTATTCTGCAATTTGATTCGAGACCGGAACCATTCTCATCATCCAGAACATGCGCGGCTGTGTCAGTTCCAGCGCAATGGTCTTGTCAAATTTACT
TGGAGGGCATGAAGTCAGGTCATCCGCACAGTACTTCGCCCCCACCGAGCCCAGGTACTTCTTTCCGTGCACTCCATGGAACCCGCAATGT