Description :
From Genome Similarity Track
Location :
Scaffold_148:104664- 105684
Sequence
1020 bases(100 bases per row)
AAAGCAAACCCAAGCATAAATAAGGGTTGCTCGCACTGTTCCCAGCGATCTACGACGCACTCTATCAGTTTTTCTTGATGAGCAAGGTCCTACTGAAATC
CCTTGTAGATATCGCCAAATGAGTGAACTACGTCTTCAAGTCGCTTTGAAGGCGATACGAAGCGAGAGATAGCGGTGCAATAACCGCCTATGCTTCTTCT
AAGATCATCCCAGAACGCCGGATCTCCAAGAACATGAAGCTGCGACGGAAATCAGTGCTCTCTTGTACTGAAGATGAAACATCTGAAGCGCTGACTGTAC
ACGTAGTAGCGACGCGAAACACCCTTGCATTGAATTCCATCTTGTTTCACACAATGTTCTCAACCCTAGCGGCTTTCCGTAAAATTTCTTCACTACCTTT
CTCGCGCGTGGCAACCATTTTGACGAGGAGGCGTTCAAGGTATTGACAGCAGTTGTAGCTTTGGCAGCAACACCACGAAACAAAGATCAACAAACCGCTT
TGACGAGATTAATCTCGTCATGTGCGAAGCAGAAGAGAAAGACAATTTGAGGCTACCGTAACGACAATATACGACGTGCACGACCGCACTTCCCCGCATT
GTCGGTAATTATCGTTCCAACCTTCCACTTCTCTTGCTGCGCTTGAAGTAACACTTGCTCAAATTGCTCAGCAATAGCAATCCCGTGATGTCTATCACCA
GCGGGCAAAATAGCGTAAGTAAGAAGTACCCCAAATAGCGCGAGCTGGCAGCCTAACAAATGATCCTTTGAAATATTCTGCCAGCCATCGGAGAGTAAAT
TAACTCAGCCTTGTGCCCTTTCCTCCATTTCCCTGAGCTCATTTGTGTCAATCGATTTGCAGCACTTAGCGAATTCTTTCAAAATGCGGTTACTTAAGGT
TCGACGAGAAGGGAGATAGTCCGTTATTCCTGGACATAGTGATAGCAGTTCCAAGAATCGCAGCGTAGACGAATGTTCGATGAAACGGTCGGGGAGATGG
TTATCAGCGTGTAGCTCAAT