Description :
From Genome Similarity Track
Location :
Scaffold_20:104648- 108546
Transcript NameFunction/comments
Phyke_g1273hypothetical protein
Phyke_g1274hypothetical protein
Phyke_g1275hypothetical protein PHYSODRAFT_259487

Sequence
3898 bases(100 bases per row)
ATGAGCGGCGCTGGGCTGCGCAACTGGCGGTGAGTTCCTCTCTGCTGTTTAGACCCTAAAGCTTTGCCAACTGCGCGTGCATCCTTCTCTTCATTTTGTG
ATTCAATACTGAATACCGTATCATCTGTTTCCATTGCAGTGGGGAGATCATCCAGCCCAAAGCCTTTGACCAAGCTATCGTGGCTAACCTAGTTGGCAAT
GATACTGttgacgaaggagctgcttcagttgCAGTAGAGGCGAGTACCCAGCAGGACCAAAACCACCAGGTGTCGTCGTTGGAGGAAGTTaaaccaccac
caagtgcAGCTGCATCGTCTCCAGACGAACGACGTCCCCTGAAGAAAAAAGTGGTCCGGAAGGACGAATTCGGTCGAGATGTAGAGGTCACAGTAGAAGA
AAAACACAGCAAGAGGGGCAGGAAAGAAAGCAGTAAGAGGAAGGACCGCAAAAGCaaacacaagaagcacaGACGCAGTAAACACCGTGATGAATCACGT
TCAGCGAGTCTACAGGGCCGTTTGGTCGGGACGCCGCCGCCGGCTGATCCATTTCGCCCTCAGGTACGTGATCATAGCGAATGCTACACCTTTGTTGCAA
TTAGTGGTAGGTTATGACTGACTTGCTATTGATGTGATACTGGTAGTTGGATGAGACGCGATTTGGGCATTCCCATCGGCGCCATAGGCAACGGAGTCGA
AGTCGTAATCGGCACGATAGCCGTGGAAGAAAATCACACCGACGGAGCCGAAGTGCGTCACGTTCCCGCAGTCCTGAACGTCATCGACGCCACTATCGCA
GCTCTCCCGGAAACCGCAGTAGAAGTCGTGGCCGGGgccgaagccgaagccgaagccgaagccCGACATCACGACCTCAACGTCGCCATTCATCAGCTTC
TGTCGAACGAAAGTGGACACACAATGCGTTCACCGATCGAAGCCCGAGTCCACTTCGGGAGGTCAACCCACTCTACCGTCCTGAGCCTGAGACCTGGGTG
TCACGAGCGGGCGGCGTATATTTGAGTCGCAAATAGCCGGAAAGGCTAAAAGACGGTGCCTTGGGAAGTTTTAAAGCGACAAAAGCCAGCTGATGAGTAC
ACTCCTCCGCGACTGGGATGAAGGTGTGCGAGCATGACACAGATGGCCGTATTTGAGTGATTTTATTGTTCCTGGCTAAAACGAATGGAGGGTGCTGGTT
TCGTCGATTCTCACTCCGTGTTACGATCTCGTGTCGGCAGGCTCCAAGATTAAGCGCAAGAAGCTTCTCGGGTGGTTTTGTAGCCGCTTTGACCCGACGC
AGGACGGTGGTGGTTTACTCGAGAGTGAATACGGGGCAGATATTGCACTCTTCCTACCACGCCTCCTGTCGTGGATGCACAAGACGACTGCTGGTGTCGT
GAACAGTATCGAAGGCGGCATCTCCATCAGGACGACTCGTCACAACAAATCGAAATTCTTCGCGCTTTCTGAGCAAATAGCTTGTCTTCATGTGTTTTTC
AGGTCGATGAATGCTCACACGTATTATCGAGAGTTCCAGCACGCAGATGGCCTTCAATTGATCCTTAGAGTCGTGGCCATACAAGACTTTGACTGTCAAA
CCGAGAAGCCGCTGGTCTCGCCATCTGACCGAGAGACATTGCTCCGCATCATTTTGAGGATCTCCCAAATGAGCCGACAGTGCAAAGAAGAAATTAGTAG
TCTTGGTGGCGAATTAGCGGTGATCCACGGAGTCCTCACTAGCGGTGACAATCGTGATTGGAAAGCAGAGTCAGGTGCGTGGACGCTGTGTCGAGAGGTC
CTTTTGGAGCAACTCGTAGGGAACCCCAATAGTTTGGACCAGGCCCATGAGGCGATTGCCTTCATGCTGACGCACACCGAAGTACATCTACAGCTCTTCG
GGGGACAGGTGAACTGCTGCCTTGTCTAGTAAGCTCACGTAGCACGACCCTAATGCATATTTGTGGCGTTGTTAGATTCTCCGAGAGCTGATTACGGAGA
GTTCATTCTGCTTTGAACCGGATTATCGGCAGCGAAAAGAGCAGGAGCTAGTTCCTCTCTGTCTCGCTCTACTTAGATCGGACGATGTTTATCTTCAACA
AGAGAGTCTGGAGTTGCTCCACTCTCTCTTGCAGTCACGTCACCTGCAGGTTTGATTATGTTTATTGACAAACTACCCTTTCAGTATCTTACCGACATGA
ACGGCGCAACAGGAACCGATTTGCGAGGCGTTAGTACGTTTAGTCGGAGAGACTGCCAAGGCACTTAATGCGTACGATTTGACTGCCACTTGTTCGCACC
TGTCGCTTTAACCTGCTAACTGCTGTTCCGAATGGATACGTGCATTTTAGCAAAGTAGAAGAGCGCTTCGTTGCTGTAGAAGGCACAACGGAACACGATA
CCTATGTGCATCTCCATTCACCATTCGTGCAAGTAACGCAAGTCGTCAACACGCTGATGCACACCAACAATAATCTGCTACCAATCCTGGTATCTTACTT
AGGCCGACATGGAAACCATTCGCAATTGCTCTGACCTCTTATGTTCTCGTGTCTAGGTGGACCAATgcacgcttcttgctccGTTGGCGTTCGTGTTGGT
TATCGAGCAGCCCCTCACACTTAAATGGCAAGCTGCCGCCATCAGTATCCAATATCTGTTATCAAACTACCAACGGGTAAGACATGCCGTGCTCAGTACT
ACTTTTGATCTTCTGATCGCACTGCTTACATACACTTTGGACATAGGCAACAGCTATGCTTCTCGCTGATCTATTCAACATCCCGGCTGCAGAGCTCATA
ACGTGGAACTGTGACGAGTCAAAAGATAGCGATGGTCAGTTGTTGGCTGAGTTCCTATTAGGCGATAGCGACGACCTGAATGACCTTGTCCTTCAATTTT
ACGAGAGCGGATGGTATCGCCCGTTATCGCCAAGAAAACAGTCCGAGTTGGCAGGCACAGACACCGTACTAAACGACATCGAGCACAGTGTTGAAACGGC
TGCACGAGACTACATCCCCGAGGTAACAACTTTATCCAGCACAGAATCTCTGACGTGTCTGTACAACCCCCTAACGTATTAACTTGTGTCTGAAAAGCTG
CAAATTCAGTATCGCGTGGGCGAAAACTCTGACGATACCGACGACGACATCGAGATGCTGGAAGCACGACGTGAGAACAACTTACGTACCCAACTGCAGA
AGCACTTTGCTCGGTTCCGCAGTATCACAGCGTCTGGATCCgccatcaacagcaagtaAAACCGACTAGAATCGACGTGAATTTAATACTGCTGACCTTT
CCCCCAACTGCTCTAATTCTCCTCGGGCGTGTAGTGCTCCTCCAGGAACCGCGagagcgactgcagctgctcTGAAACGACCTTGACCTTCTCGCGGCAG
ATCTCCACGTCTTTCTCGGCTCCGTACGTACTGCGGGCAAATGTGCGGTAGTCCGAGACCAGGTGGATGTGGCTCGCCAGTTCCGTGTGGATTTCCTTGA
TCAGCTGGAGGAACTCGGTGCACGAGGCGTTAAACGCCACCGATGAGCTCTCTTCGGAAGAGACTCGAGGCGTCATATGCGTCATGGTTGTAGCTGCTGT
GCGTAGTGCCGCCACCAGtttctacagcagcagcagtagcaacagaGAATGTAGTGGACGAAGTCAGTACGAGGCAAGAGTGTGAATAACCATTTGAGTA
CAGAGGCCATGGGGCTGGGAATTGCTGTAGGATGTAGTGAACCTTCTCAACGGCATCAAGAGCTTGGAGTACCGCTACGTGCCGAGAGCTGGACCACGGA
TCCGTCACCTCGGAGAAATGCACACGACTGTCGCCTTCGCTCTCCATTTTTGTATCGCGCAAATTGGGCAAGACACTAAATCTAGACTAAAATTTATG