Description :
From Genome Similarity Track
Location :
Scaffold_397:10464- 11738
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_397-snap-gene-0.10Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_397-snap-gene-0.11Serine protease family S10

Sequence
1274 bases(100 bases per row)
ATTGCGGTTGCAATGTGTGTATGATGTGGGTGCAGTTTTCGACCGGCGCGGCGCTGTTTCTGGAGAANNNNNNNNNNAGCGCCGCGCGGAGCTGATGCTC
TACTGTCTGAGCCGCGCGCTGGACATCGTGTGGCGCCTGCTCAAGCGCCGCGGGCTCGTGCGCTATGTGCAGCACAGCGAAGTGGCGCTCTTCTCGCTCT
CGATGGCCGGCATCATGTCGAGTCCGCCGGAGCATTTCAAGCCCACGTACCTGCGCATCCTGCGCTTTGTCTTCGGCCGCGACATTATTTAATAACACAA
GCGGTGCTGCTCTCTCCCCTCATCAAAGAAAATACACGTATAAAGTGTTCTTCTTTTTAAACAAAAGCGGCCACCTTCGCGTGTCCTGTGTCATTTGGAA
AGGCGGTTGCAGCCATGTGAGCTGTGCGCATGCACGTGTTGTTTGGTGCGCGTCTGGTATGCTGTTTACAGTATTTGTATGGGCATTTGGATGGGGGCGT
TCTTCTTCACGTGGACAGCTGACAGCGCAGATGCCTCACAACGAGAGCCATCCATGTTGGATCCATTTTAAAGACGCATCTTCTCACTTGGCTCATTCCC
TCTACATTACGCGATAGCCTGATTTCCTATATTCGTAATACATATTGGTCATTTAAATTCTTTGATAGATATATTTATCCTTTACTGCATATTAAATCGA
TGATGAACTTCCTTACATGTATTATATCTTACAGGCCCTTTCATCATTCGAATTCTGCTGTTCACAGCTAACGTTCGACGAACGTTTCCACATACAATCA
GTCAAGCCTGTACTAGACAACCTGCTGAAATTTATTCTTTTGGTACTTTGTAAATCATTCCTTTCCTATTTCTACTATCAAACAATACTATGATGGTTTT
ATAAACCTATGAAACGAGACAAAATTGACAGTTGCACCGCAGCTCCGAGGACAGGTTTGACTGTCCCGTAAACTTTGATTTTCCACAAGCATTCGTAATC
TTTGGTTTTCCACACAAGCATCCCAGGTTCAAGCGCTATACAAACATCCATATAAAAAAGGAAACTCACAAGCCTTTTTCACTCTTGCTTTACTCCGCCA
TTCCGCAATTTCGAGCAAGCGAAAGAGAAACAGCTGAAGATGCGGAGCCACTACGTGAGCGAGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCGG
GCATCGCGACGCGCATCGCGCCACCGCAGTCGTCAGGCGCACTGCGCCACAAGTACTCGCTCTCGACACGCGCG