Description :
From Genome Similarity Track
Location :
Scaffold_139:104614- 107269
Sequence
2655 bases(100 bases per row)
ATTGACACCTCAAAGTACAAGGGAGCCGACGAAGACTCCCTATTGAGATGGTTCGTGGAACTCGACGATGCCATAAGGCATCGTCATATCATCGATGAGG
AAATGCAGATCGCATTTGCTCAATCGAACTTGGCAAAACGTGCAAAGACGTGGGCCTTGGGCCTTAAGTTACACGACCCATATGTCTTTGGGTCGTTGGA
AGTCTTCTAGTCCTTGCTAGGGCAAACTTTTGAGCCGCCGCAAGCGGAGTTCAGGGCTCGCTCTGAACTCCTGAGAATCAAGCAAGGTAAACGTGCCGTA
CACTCGTACATTCAGTACATACGTCACCTTACCAGTTGCATAACAGTCGACCCGCTGAACCAACAAACGTTGATTACTTTGTTCATGCAGGGTCTGACTT
ATGGTCCTGTTAAAACGTACCAGTTCCGGTTGGAATTCAACACCCTGGAAGAGGCGATAAGGGTTGCGGAACAGGAGGACTTCAGCGTGAATCAGACTCA
CGCGAATTCGAATACCTATCGTCCATCGAGACGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTCATGCGGTTAGCGAGAGCTCTCGTGTTTAT
AACTACAATAAATTGCAAAAATGCAATAGATGTCAGAAGACAGGGCATTATGCATACGAATGCAGTGACCCGAACGCGGTAACACGTACCGCAGGAAACA
ATAACCGCCAAGCGGGCAAGCGGGGCCCAAGGCGTGGGTCCAACGTTGTTGCGAAGACGCAACAACGAAACGGTCAGCCAAAAAACGGTCAGGGTCAGTA
GGTGCGGAGCACCCTACTGATCCAGCAACGTCGAGTGATTTTACAGGCCTCTTGACGAAAGTTGCTCCCAACACTCAATCATTGTGTTTGCTGCTTCTGG
TAATGAGGTTTCCCTCATTACCTTGAAACTCGAAGTGACACAAGGCATGTTGCTTCAAGCTCTAGTCGATTGTGGGACGTTGAACAACTTTGTACGAAGC
CAGTCGCTAGACAAAAGAGAGATCGAATATGTTGAGCGAGAGATCCCTCCAACGAGGATGACGGTGCGCCTCGCGACAGGCGCATCCGTAACAGTGATGA
AACGTGTAGTGGGTATTACCTATACACTGAAGGGAGTCCAATACGATGATGAATTCATCATATTAGACTTGGATGAAAAATTTGGTCTTATCCTTGGACT
GCCGTGGCTCAGAAGGTACGAGCCACAAGTCAGCTGGCATCGACGAACAGTCGATGTGCCTTTCACTTGTTCATCAGATGGCCATCTGATAAAAGCCATG
GAGCGCCCACTAACATGTGGGTGTACTACCAGCGAGTGCGATTGCCTCGCGTGTGGTTCGGTCGTTAGTACGACTGCACATGGCCATGGAGTGGCTGATC
ACCACACCATGAAGTCAGATTCCGGCGACTGCATTAAGATGAAGGTCGCGCGAAGGCCCACCACCCGAATAAGTCGAGTGGACTGGGGCATGGGTGTCCT
CCAAATGGACAACATCCAAGTGAAATTGAACCGATTGCCAATGATTGGCAATACGATGATATTAGTTCGATTGGAGAATCGCACGTAGAAGACCTGGCCG
CGGTAGCGCAACCACCTCCAGAGGATAACGAGGGAGCAATTCCACTCGTGTCAGATGATGAGATAGTCATAGAGGCTAGTGAGGGAATAAGTCCCCACTC
AACTGTGGAAATAAGTTCCCAGGAGACAACAGAGACATTAAATGTCTTAGTCAATGACGGATCAAGTATAGGAACTTACCAACTTGATCTGATCGCGCCT
CCGAATACAACTTCGGAGATCATTCAATTGCCCACGCTCGAACAGAAAAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAATCAGATTTGCGTAATCG
TCGCGGAAGACGAGTACGTAACCGATATTCGGTCGGCAATGGTATTCGCTGAGAACGAAAAGGTTCAGTAGCTCATCCATGGACGAGCATGTCCTTGATG
AGAAGACTCGGATTAAGCGATACACATCCCAATCGTGGAAATCGCTCAAGACAAATCCTCTCCACGATGATTTGACGGAATTCAGAGAAGGCTTCCCAGA
AACAGTGCCGTGCGAGCTACCCAAGGATAAGGGTACTCGTCACGAAATAGACCTGAAACCAGGGTAAAAGTACTGTGTCATGAAGCAATGGCCATTGCTT
CGTGAACAAGTACTAGCGATTGACAAATTCTTTGCCGATCGCTTGGCAGCAGACCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGACCTTCTGTG
TCCAAAAGGCCACAGGAGGATGGCGGATAGTACATGCCTTCGACAAGTTGAATGCTGCCACTGTATCGGCTCAAACGCCGATACCAAGAAAGGATGTCAT
TGTACATGGTATGTCAAGGAGTACCATCTTCTCATCGATGGATCTGATGGAAGGGTTCTATCAGATCCTTATGCGCGAAAAGGACATTCCTTATACAGCA
GTAAGCACCCCAAGTGGTATGCTTTGGGAGTGGCTAGCAATGCCACAAGGGCTGAGTAATGCCCCTGCTACGTTCAACAGATGCGTTACGAATCTGTTGA
GATCTGTGCGAGAATTTTCACCTAGCTATTTCGATGACGTGTTCGTCCATAGCCA