Description :
From Genome Similarity Track
Location :
scaffold_13:104610- 106411
Transcript NameFunction/comments
g819.t1 hypothetical protein PHYSODRAFT_490992
g820.t1 conserved hypothetical protein

Sequence
1801 bases(100 bases per row)
AATCAGAAAAGCCCGGTTTTGGACCAGTAACATGCCGCCGGCACGCATCATGCCTGTCGCACGGCTGGAGCTGCGCGGCTTCAGCGCCGATCGCGGCCGC
TTCTTGTTGATCACAGCACGCGCCGCCAACAGCAACAATGACGCCGACGTCTTCACTACGTCCGCACCCTCCGCCCGCATATTCGAGCGCGACCTAGCGG
ACTTGCAGACGTGGGACCGGCACCTGCGTCGCAACGGTGTCGGCCATCAACGTCTCCCGACCAAGCGCCTGCGCAAGCTCATGGCTGGCAACTGGGTACG
CGGCGATCGCACTGCTGGCTGGCGCATGGAGATGCAAAAGATAGTGAGTGTCTGCGAGAACTGGATCAATGCGGCGTTCGAGAAGCTGCCGGCGGCGATG
CAACAGGAGTTCCTGGACGACGACCTGTACGTGGCGGCCAAATGCAAACGCACGGCTGTCCGAGCGGATAGCAAACACGCGCGAGACTTGCAGCAGTACT
TCAGCAGCGCCGAACTGGTAGATCTAGTGGTCAAGAGAGTGATGCAGTATTTGCACCTGCAAGAACAGGGTGACGCCGTCTGGCTCGAGCCTTCCTGCGG
CGACGGCCGCTTCCTGACAGCACTGGTACGCGCCGGAGCGCGGCACGTCGTCGGCTACGAGATAGACGAGAGGCTTCACGATATCGCGCGGAATTACGTC
AGACAAGTAGCGGACGCCGCCGGAACAGGTGAACACAGCGTTGATGCCCAGGTGTATGCGGGTGACTTCCTGGCGTCCAAGAGCTCTATATCTGCCGACA
GCTTCGTCGTAGCGATCGGCAACCCGCCGTTTGGCGCGAAAGGCGGCGACGGGAGCGATCTCGTGCACCACTTCTTCCGGCACTCAGCGAGGGAGTGGCG
AGCCCGCGTCATCGCGTTCATCGTGCCGGAGAGGTGTTCTCGGCCCGCATTCGTGGAGACCACGTTGCAGCAGCTCCAGGGCGACAACAGCACTGCATCC
TGGACGTTGGCGACGGAGCTGTCGCTAACCGACCACCAATTCGAGTTCGGGGCCGGAGACCAGCTCAAGCGCGTGCGCCAGCCTAGCGTCCTGCAACTCT
TTGTGTGTCTGTAGAGATGACACCAGCGATATTTGACCCAACGCCTCGAACACGTACATGTTACCATCGTCTAGTCGAGAGGATCGCTCTCGGATGTGCT
CGTGTTCAGGTCCACCTCGTTGTACCTGCACCTCGGTGAACCCCCTATTATCTTTTGTCTTGATTAAACTATTGCGATCGTCCTTTTGTGAGGACAAGAC
AAAGAAGGTCGCACCCAGCGTCACCTCAGTATCGAAAGCGACCGGGGAGCTCATGAGCAGCCGTCAAGGCGAGTGGCAGCGCGTGCAGGACGCCCAAGGG
CGTTACTTCTACGTGAATCACGCGACCCGAGAGGTGCGTCTGTGTATCCATACTTCGTTCGGGCTTCTTGCAGCTCTGTAGCCTGCTCTACGGCCATTCT
AACCCTTGTTGTGTGTATTTCCTCGCAGACCTCATGGCACCTGCCCACACCGGACCCGCTGCCAGCCGGCTGGGAGGAGCTCATTGACGGCCAGGGACGC
GTCTACTTCGTCGACCACAACACCCGCACCACGACGTGGATGGACCCGCGCGTGGCGGCCGCGCGCCGCCGTACGCGCGGCCAGTCCGTGCTGTCGTCGC
GCCCACCGTCGAGGTCTAATATTCCTCCTGTCCCCCCGCTTAATAACAACAGAGGACGCTCGCCCACGTATGAGGACCCACGCGGCGCGTCTAACGGCAG
C