Description :
From Genome Similarity Track
Location :
Scaffold_1:1046035- 1048353
Transcript NameFunction/comments
g328.t1XP_009519720.1 hypothetical protein PHYSODRAFT_482793 [Phytophthora sojae

Sequence
2318 bases(100 bases per row)
CGTTGAAAGATTTATTCCGGCTTGGAGACGCGGCAGTTGGGCAACGTCACGAGCCGAGAACGTGTGGGACGAGTGGGTTCTCGAAGCTAGTACCCGCATT
CAAGATGCTCGTAAACCTTTCGCAGAGCGACGAAGGCTTGGACTAGGTGGTAAGCTTAGGTCATTTCCGAATTCGACACCAAGAAGTAAAGCCACCAGGA
GAAGAATCGAGTCAAGGGCTACAATGACCGAGTCGGTGACGGGCCAAAGTGTGGGCATCGACCTGGGCACGACCTACTCGTGCGTGGGCGTGTGGCAGAA
CGACCGCGTGGAAATCATTGCGAACGACCAGGGCAACCGCACGACACCGTCCTACGTGGCCTTCACGGACACGGAGCGCCTTATCGGCGACGCGGCCAAG
AACCAGGTGGCCATGAACGCGCACAACACGGTGTTTGATGTCAAGCGTTTGATCGGGCGCAAGTTCACCGACCCTGAAGTGCAGTCGGACATCAGGCACT
GGCCGTTTAAAGTGGCTCGAGGTCCGGAGAATAAGCCGGAGGTGGTGGTGCAGTTCAAAGGTGAGCAGGTGACTTTCCAGCCCGAGGAGATCTCGTCCAT
GGTGCTGGTCAAGATGCGCGAGATCGCGGAGGCTTACATTGGTAAGCAGGTGAAGAACGCAGTGGTGACGGTGCCGGCCTACTTCAACGACTCGCAGCGA
CAGGCGACCAAAGATGCCGGTGTCATTGCTGGTTTGAACGTGCTACGTATCATCAACGAGCCGACAGCCGCCGCTATTGCCTACGGTCTGGACAAAAAGG
GTGGAGAGCACAACGTGCTGATCTTCGACCTTGGTGGAGGAACGTTTGACGTCTCGCTTCTTACTATTGAAGACGGCATCTTCGAGGTGAAGGCGACGGC
AGGCGACACGCACCTGGGCGGCGAAGACTTCGACAACCGCCTCGTCGAGTTCTTTGTGCAAGAATTCAAGCGCAAGCATCGCAAGGATATGACGGTGAAC
TCGCGCGCGCTGCGGCGTCTGCGTACGGCGTGCGAGCGTGCCAAGCGTACACTGTCGATGTCTGCGCAAGCGTACATCGAGATTGACTCGCTGCTGGATG
GTGTCGATTTCAACTCTACCATTACGCGCGCGCGGTTCGAGGATCTTTGTGGTGAATTCTTTCGCAAGACAATGGACCCAGTGGCGCAGGTTCTACGAGA
CTCGAAGCTGTCGAAGAGCCAGGTGAACGAGGTGGTGCTAGTGGGCGGCTCGACTCGTATCCCGAAGGTGCAGCAGTTGTTGATCGACTTTTTCAACGGT
AAGAAGCTCTTCAAGTCCATCAACCCGGACGAAGCCATAGCGTACGGTGCTACAGTGCAGGCGGCCATCCTGAGCGGCCATGACTCGTCGTCCAAGTTGC
AGGACCTGCTGCTACTGGACGTGGCGCCGCTGTCTCTTGGCTTGGAGACGGCTGGCGGAGTCATGACCAAGCTGATCCCGCGCAACACCACGGTTCCAGC
CAAGAAGGCGCAGTCGTTCTCGACGTACGCGGACAACCAGTCCGGTGTCTTGATCCAAGTGTTCGAGGGTGAGCGTTCGATGACCTGTGACAATCATCTT
CTGGGCAAGTTTAACTTGGACGGCATCCCGCCCATGCCTCGCGGTGTGCCGCAAATTGACGTGACGTTCGACGTGGATGTCAACGGCATTTTGAACGTGT
CGGCCGTGGAGAAGTCGACGGGCAAGGAGAACAAGATCACCATCACGAACGACAAGGGCCGGTTATCTCAGTCCGAGATCGACCGCATGGTTGATGACGC
TGAGAAGTACAAGGACCAAGATGAACGCAACAAGCTGCGCATCGAGTCGAAGAACGCGCTGGAGAATTACGCGTTCTCTCTGCGCAGCTCGACGCGAGAT
GAAAAAGTGGCGGCCAAATTGAGCGACGAGGACAAGAAGACGATTGAGGACAAGGTGGTGGAGACCCTGCACTGGTTGGATGCCAACCAGGCGGCGGGGA
AGGAGGAGTTCGACGCGAAGCAGCAGGAGCTGGAGGGTGTGACCAACCCGATCATGCAGAAGATTTACACCGCGGCGTCTGGAGCTGCTTCTGGAATGGG
TGGTGCCGGGACTGGTGGTGGTGCTCCAAGTGGCGCTGGAGGTGCGGGAGGCGATGACGGCCCAAAGATCGAGGAAGTGGATTAAGTGAATGGCGGCGAA
GCGGTTGAAGGAGAGGGTGAAGATGCCGCGTATGCTGCTGCAGCTTTGGAGGTTACGATGCCGATCCGAATTCACCCTAATTCGACTTCTTGTTTTTGAT
CTTGCGTGGGCTTGTGCG