Description :
From Genome Similarity Track
Location :
Scaffold_104:1046- 3086
Sequence
2040 bases(100 bases per row)
AGCAACGCCAATGCTTCCTTCTATACTGTCGCATAGTTGATTTCGTTCGCCTTCAGCGTTCGACTGGTGAAATTAACTGGCCAGTACATGCCATCATATT
CTTGGATCAGGGTCGCTAATGTGACCCACTTGCAGGCATAGACCACAATAACTGGAGTTCAATCTGGGTCGAAATGTCTTAACGACAGAGTTGTTGCGTA
TTCGCTTTGAACATAGTGAAAGTAATTGTAGCCTCTTTCCATCGATATTCTTTTTTCGTCTTCAGACTGCTAGTCTTTATCCATGCGCTGAGCCCGGCCA
ATCTCGTGTAAATCCGCTTCTCGAAATTCATACAGCACAGCCGCATATATCACGCAGTCCTCAATGAAACGGGGCTGAAGTAGTTCAGACTTCCGAAAAA
AAGATTGCATTGCCGCAACGTGCTAGGAAATGGGATGTTGACCATCGATTCTAAGTCCTTTAAGTGCGCTTCGAGACCATCGTACTGGACCTGATGTACT
AAATAATAGACCTTGCGATAACTCCAAACACGCTTTGTAAGAACGATCGACAAGTTCCATTTATTGCAAGTTCCTATCAATCTCTCCACATTCTTACATA
TACAATCCCACGTCCTTGCCGGGATAAGAATATCGTCGATGAACGATCTTCGCCCCAGTATGGATGATTGCCGATCCATATTCAGTTTACCTTCTTTGTA
CTTGTCTATCCTCCCTTCTGAGAGCGAACGTTTGGCGATCTTGAGGTATCTATAGATCCATATTCAGTTTACCTTCTTTGTACTTGTCTATCCTCCCTTC
TGAGAGCGAACCTTTGGCGATCTTGAGGTATCTATAGAGTGCATGGTCAACTAGACGTTGGTATATATGAAGCGCATTCTTTAGTCCGAAGGAAATTTGA
AGCCATTCGAAAATTCCGAATGGTGTGATGAACGTTGATATCCACTTTCTCCACTTGCTCTTTTCCACAACCCAAGAAATCCTCTTGCCATGTCCAACGA
GCAGTACCAAAGGGCTTCGTTTCGATCTTCAAACAGATCGCTGACCAATGGCAGTAGTTAAACCATCAAGCAAATTTACTATCCCACTCTGCGATAGTAG
ATGCATAGACGAATGTTGACTCTATTATTCTTGATGACCACCATTATAAGAAACGCCCACGATGAAGTAAAAGGCTGGATAATCTTCGCCGTCAAGAGCC
CTTTGATGAGACCGAAAATTTTTCTCCCGATACTTGGGTTCTACTGGCCGAACTCTTTGCGCTATCGGAGAGGCTGTGATTGCATCTGTATCACAAGTCA
CGCCGCATGCTTCTAGAATTAACGCATTGACTTCCCTCATGAGGACAAGACGTCCATTTCAAATCAGCGCTCTGAGCTTTCTGCTAATCTTCCGTGAGCA
GGACATTGGGTCATCGATCAGAATGTCGTCAATAGTCACATCTTCTTTCAATGCCGCTACTTCCGGCAGTACTTCTATATGATGCTCTACATCCTCAGCA
AACAGATCACCGCTCTCGTGATATTAAACTTGTGTCTCTGTGATCTTGTTTTCCTCGACATCTGACGGCATCTCTATATCTGGGGCTACCTTCATTTTTG
CATTACTATTTTTGACTAGTTCACCTACCGGATTGGGACTATTTCTGCACGACCCATAGTCTGGTGGTTGGAGATCGATCCTGCGAAATTCATTGTTGTC
GGCCAAAGCATCTCGTCATGCGAGGTCAAATCAGCAATATCGACCTGTCCTTCTGTTGAAATGTCAGCGTCTTTCTCGTGAGGTCTTCCTTCAACATCCT
GCTGTATCTTCACTGTGTTTACTGGTGGCACGTCCTTGATCTGGCGGTCGGTCGTTTCATGATCTGCTCCAGAGTGACATATTTACGATGTTCCACAAGT
GGTCCGATCCATTCTTGAGGTGGGTCATTTAGTCGATCCACTATAGCTACATATGCCAGCGTTTGCCATTTTTGATATCAGCGCGACCCCACTGACACAT
AGCATGGAATTTTGGTATCATATCGCCTCTCATCTACATT