Description :
From Genome Similarity Track
Location :
Scaffold_596:10458- 12348
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_596-fgenesh-gene-0.3Translocation protein SEC63

Sequence
1890 bases(100 bases per row)
GTGACGCCGTCTATTTATCCTTCTTGCTCTCGTCGGCCACCTCCTCGTCCTCCTCCTCCTCACTATCGCTCGAGTCGTCCGCGTTCATCACCTGCTCGAA
CAGCGTCGGCTCGTTATCTAACTCCATGTCCTCCGGATGCGGCTGGTACACTGGGAGCGACGACGCAGCAATCACATTAAACTGCACACACAAACAGATA
ACCACATACGTCAGCCACTCGCACCAACAACGACAACAACAAATAAAACACAAGCAGCCTCACCTTGGCCAGTGCGCGCAGGTCGAGGCCAATGTACGAG
TCCGACTTGACAAAGATGTCCAGCTGGTAAGTGCCCGCCTTCGGCGGCGCCTGCAGCTGCAGCTTCAGCTCAGCCGTCCGCTCCTGCGATGTGATCTTGC
CGAACGAGTGCAGGTGGTTCGTCTTGGCGTCCCCGACGACGCAGAACCAGCGCTCCGACTTGGGGTACGGGAAGTGCGGCGCATACACAAGGTCGCACGT
GTCGCCCTCGGCCACGTTCTTGCGCGTCAGCTTGACCGTGACCGTCATAATGTCACCCTCAGCGATCTCCTGCTCGTCTTCGACGCCAATCGTGATCGCC
AGCTCCATGTGCGGCATCATCTCCAGCACCTTGTTCACTTCCGCGCGCTGCTCGTCCGTCAGACCGCTCAGACCCTTGCGCTGGTCCGGCTCCATCGCGA
GGTACTGGTGCATGCTGCGGCAGGCGTTCTTGCCCGTCACAATGTGCTTCACCTCGGCCTCCGTCAGGTGCGGCAGCTGCAGGAACGGCGGGTCCTTGAA
CCAGAGCGCCTGCGACAGAAACTGCTGCAGCTCAATCAGGTTCACCGTCGTCTGCAGCCAGTTCTTCATGACCGAGATCTCCAGCATGCCGTCCACGAGC
AGAATGACCTTCTTCAGCATCGCGTGCAGGTCCTCCTTCAGCGCCGGGCTCAGCTTCTCGCGCATGAAGTGGGCGTGCAGCAGCACGTTCGCCTTCGCGA
TCGCCGGGTGCTGGAACTTGGGCTTCGCGATCAGCTCGCTAGCCTTGAACTTGCGGAACAGCGAGTTCAGCTCGGCGTCGTCCGTGGTGCGGCGCGGGAC
CTCCCGGAACTCGGCCGAGCCGGCGAGGATCTCGGGCAACATGCGCGGGTGCGAGTGCTGCGACATGGCAAAGTTGTAGAAGCCGTACGTGTCGTACATG
ACCATCGAGTCGCCGTACTTCTTCGAGTGGCTGTACCAGAGCGCGACGCACGACGGGATCGCGACGACGAGCACGATCAGGTACAAAAAGAGCACGATGT
TGTGGTTGGCCGGGTCCATGAGGAAAGTCGGGAGGCCGATCGAGAGCTGCAGCGCCTGGCGACCGTCCGGGTTGCCGAACTTCTCGTAGTTGGCCTTGGC
CACCTCATCCGTGAGCGCCTCGTACGCCTTCGCGACCAGCATGAACTTCTGCTCGGCCACAGCGTCGCCAATGTTCTTGTCCGGGTGGTACAGCAGACTC
ATTTTGCGGTACGCGCGCTTGATCTCGCGCTCCGAGGCGCCGGCGGCGATCCCGAGGATGGCGAACGGGTCGAACGACTTGATCTCCGAATCGTCCTTGA
GCAGCACGAACATGCGGAAGAGACCGTACCACATGACGGCGAGCACGAGCAGGTTGCCGACGAACAAGGGCGAAAACACCTTCGAGAGCTTCGTCTTCTC
GGCCTGGAGCTGCTTCATCTTGCGCATCTCGCGGTCGCAACGCACATTCTGCTGGTCGATCAGTCGGTCCTTCAAGAACACCCCGTAGAGCACGCGCCGC
AGTGACAGGTACGTCACGGGCACAAGGTAGAGCACGCAGAGCGAGACGGAAAAGTAGTAGAACGCCGAGTTGTCGTACTCCAGCATGGTT