Description :
From Genome Similarity Track
Location :
contig_2:1045762- 1049249
Transcript NameFunction/comments
g669.t1hypothetical protein PHYSODRAFT_311060
g670.t1hypothetical protein L914_06274, partial

Sequence
3487 bases(100 bases per row)
AGACGGAGGAGCTCCGGTTCGAGATGCTGGAGGACGACGCGGTGCGTCTGCTGGAAACGCGCAACGAGACGTACAAAATTCAACGGGCGGTCAAGGCCTG
GCTGGAGAGCATGGCGCTGGAGACACTATCAGTATCAGTGACAAGCGCGGTGCCGGTGGATCGCGCACCCTCAGGATGATGCGCAAACAGGGGTTCCCAG
TAGACGATGATGTCCATATGGACCCTGATGCGGTGCTGCGCGACGGCGACGACCACATCCTGCCCGATGACACGGAGGATGAGGCCGAACTCATGAAGGC
GGTGTGGTTGTATGTCCGTGCTGGACGCATGGACGACGCAATTGATCTGTGCATTTGTTTAGGTCAGTCGTGGAGAGCTGCAAGTCTCTCGGGAGGCAAC
CCCGTCGGTGCAAGCGAGAGCAACGAGCGTGAGGATTTGTCACTGGAGCGATGGGGAAACCCGTTCCGTGCGCTTTGGAAATCAATGTGCTGGCGGTTGT
CGGAGCAAGCTGTTGATGGAAAGCTGTCGAAGAGCAGCAGCTTGCTTGCGAAGAAGTATGAAGAGCTTATTTATGCGGCCTTGAGTGGTAACATCCAGGT
CATTACCAAGAGCTCGTTGTGTGAGAGCTGGGAGGACCACTGCTGGGCCTATCTGCAAGGTATTACGGAGCAGCAGCTCGACGAAATATTGTTCAAGCTG
CTCAAGGTGAAGGTTCAGTCATCGCGGTTGATTGTCGGCAACAACGCTCACTATTTACGTCATTACTCGACTTTGTTGGACAAGACGAAGTACTTAAAGC
GCTACCAGGTGGACCTGGACACGCTTGTTCGATGAGCTGCGCGGAAGCCAAAGCGAGCATGTCCGCATCCAGGCCAACCAGCCTCACCGTCAGATCCAAG
CCAAGTTGGTGACTGCCAAGTTTGATTACATCGTGTCTCGCATTTTGGACACGCTACTATTCAACCCGGAGGACGATTCATACAATTGGGATCTCAAGCT
GGACTCTGCTGTTCAGTCAGACGGCACTTCCTCGCTGTTTTTGCGCTTTGCCGCTCACTTCATAATGTTCGCTGGCTTCACTGGCGAGCATTTTGACGAG
CAGGCGGGTCACATGATTTTGAAGCTGTATATTCGTCACTTGGTGCAACACCGCCAGTTGCAGTTCGTGCCGATTTACGCGTCTCGACTACCTGTAGCAG
GCGCGATCGAGATCTACGTGCAAATGCTTTCTACGGTTGATGACAGCTTGGAACGCGAGTTGTGCATTAAGCGAATCCTGGAATACGCTGGAATGGATGT
ACTGTCAGCGGTGCTACAGTCTGTGGTCGAGCGTCTGTGCGAAGAGTACCGGTCGGTAGCGCTAGGAGAGCAACAGAAGAAGGGCCAGCCGGTCCATCAG
ACGTACCCACTTCAGAATTGACAGGAGGCGGATCCGGGCAATCGAGTTCTTGTGCTTTCACTCCGAGCACAGAGCGGAGGCGTTGGTTCGTTCTAATTTG
CTCACTCGACAATTTCTTCTGGAGGGGAAGTTCGCTGCTGTAAAGGAGCTGGTCGAAGAAAACTTGCCAGAAGACTCCATCGGCGTGCTTGACATGCATC
GTGCCGCGCAATTGCTGCGCGACGACGACGAAATTGAGCAGGCCATGCGCGAGTACCTCTGTTGGCGCGCATACATTCAGGCGTGCGCACAGTACGATCT
GTGGAGAAACTGCATCAACAACCCTGGCGCCGAGGCGCTGTCGCTGTATAGTGAGGAGAAGGACTACCTGGCAGATCTGATGTTCCACGTGTCGCGGTCA
ACTGCAGCCACGCTGGAGGTCCTGCACTTTGAGAACGGGTGGCTCATGGGTTGCTCCAACGATGCAACAGAGGACGCGGCCATACGGGAGCGTTGCTTGC
CGTCGCTGGTCTTCAATTTGCACTTCATTCAGCTTGAGTCGGCCAAGACAATTATGCGTCTGAACCATTACCCGGAGGACGCCAAGGCCGAGCTGGCACG
ACCGCTTCTCGAGAAGTCAATTGAGGTCGCCGATGTCGTGGCCGACGAGCACTACGCAGTGTATAACGCGCTGGACCAGGACCAATGCCGTGACCTGCTG
CATGGTTTCCGTGAGAGTGCTGTTTCGCTGGCGTTCGTTGAAAGTATGCCAACCCCGACGATTTCTCCCGACTCCGATCAAGAATAAGCGCGAACAAGCA
ACTACCTGTGACAATTAGAGAGATGAAATCGACAGTGAGGAAGCAGACTCTATCTCGTGGTTTTGTTGGCTGTGTTGTTTTTTATCGATGGTTTGTTTGG
AAAGTGTTGTGATGACCTGGTTGACTTTGTGCCAGTAGGAATGACGTTGCTCTGGTGGTTACGGGTGAACAGGGGCAGCAGCCTTGCTGTAAGCTCCCCC
AGAACTGATAGCGCCAACAATGTACTCTTCAAACAGAGTTTTCTTGCGGTCTGCGCTGTCGATGTGATCTTCGAGCATTTTGTGCGGCACTCGCCAAACC
TGCGGACATGGCAACCCGGGCTGGTTCCATGTCCACGCGTGTTGGTCACGGCTGTCGCCATTGTTTTTCTTTACCAGCAGCACGTTTTGAATCCCAAAGT
CTCGAGAAACTGCTTCCAGCCGAACATCGTACGCACCGCTATCAGTCAGAACACGGCCGTCGGGGACAAACGGGGCTGGACGGGTTTCAGATATGCCTAC
CACCCCGGTAAGGTCGGTTAGAACGCTGTTTGTGTAGGCTCCTCTGAGCTGGAGCACGCTGGTCCCGATGGAGCCATGAAGAAGCGCACATTCGATTCAC
GATATTCACCAAACCACGAAGAGCAACGCGTCGTAGTGTGGAAACAAACGCCGTCAATCGTCACGTAGGGGGCAGAGGCACTAACGGGGCGGATACTTAT
GTCGATCTGAACCAGCTTTTCGCCAGTTGCAAGAGGAACGCAGTGCACTTGGTAGGGGCTGCCAATCTCCAGGAAAGTCGCGTGGAGTTGATTCACTAGC
TCGTCGAACATCTGCGCACTCTCGAAAGACTGCACGGACGTCACTGAACCGCCTTGTATGCCAACCAAAACCCAAGAGGTGACGCTGGCGGGTATTCTGC
AATTTGATTCGAGACCGGAACCATTCTCATCATCCAGAACATGCGCGGCTGTGTCAGTTCCAGCGCAATGGTCTTGTCAAATTTACTTGGAGGGCATGAA
GTCAGGTCATCCGCACAGTACTTCGCCCCCACCGAGCCCAGGTACTTCTTTCCGTGCACTCCATGGAACCCGCAATGTGATGTCCTGCTGGGCACTCCAT
GACTTTATTGTTCGGTCCTCTACCACCCCAAACCAGGGACCAACGCGCAGTGTCGAGGTGAATCGGACACAATCAATCCAATCACCGCTCCACACCTCAA
GCTTTACCAGTTTCTCACCAGACACAAGCTGGAAAACGTGCTCGTTAGAGCGGTAGAACTTTGGATCTTTGGCGTTGGCCGCGGCTT