Description :
From Genome Similarity Track
Location :
Scaffold_76:10456- 14309
Transcript NameFunction/comments
g13503.t1hypothetical protein

Sequence
3853 bases(100 bases per row)
ATTCATGGCAAGTTCGCCTGAAAAAGGTGGCTCCAGTGAAGTGCCGTTCGCCCAACTGGTGACGCCACGCGCTGCTGCCCCCAATTTCGTTGAAATCGAC
AGGAAAACTTCACAATGCTTCAGTGACCAGCAGAAGTTAGCGTCCAAGTTTTCGTTCCTGGATCTGTACCGCTTCGCGACGCCATGGGACCGCGTGCTAA
CCATCACGGCCGTCCTCATGGCGGCAGTGAACGGCGCACTCTTCCCGTGCATTGCGTTGGTGTTCGGCAAAGCCATCGGCGCCTTCGCCCAAGTTGGCGG
GGGCGTGGATCGTGGTACCTTAAACAGTGCAGCTCTGGACTATTTTCTGATAGCCATCGGGCTGTTTGTGACGGACTATTTGGCGTATCTGCTGTTTTCA
CTATCGGCCGAGCGCCAGATGAAGGCTCTGCGTGCTCGAGCGCTGCAGCACATGCTGTACATGGATATTGCGTGGTACGACCTTCACGACCCACTGCAAT
TATCTACGAGAATCACGGGAGATACTGTCAAAATCAAGGACGGGATGGGGGAAAAGCTGGGCAACGGCATCAAGTATATATGCCAGTTCGTGACGGGCTA
CATCATTGGGCTTGCTCGCGGTTGGGATACTACGCTGGTGATGACGTGTGTCATTCCTGTTATGGGCTGGTCGATGGGATTTGTCATGAAAAAGTGGCAA
ACGAGAGCCACCTACGCACAGCAAGTGTACGCCCAAGCAGGAGCTGTGGCGGAAGAAACGCTGGGCGCCATCCGGACTGTAAGTTCTCTAACGGCTGAGC
AACGCGCGTTGGACAAGTACAACCAGCACACTGCCGAGGTCGAGAAAGGGAACATCCAACAGAGCAGAATGCTTGCGCTTATGATTGGCCTTTGCCGGGC
CTGTGACTGGCTCATGTATGCCGCTGGCTTGTGGTACGGAGGCTCCAAAGTGTGGAGAGGAGAAGCCTCGCCGAAAGCTGTGTTCCAGGCGTTGATGGGC
ATTCTCATGGGCATGAGCTCCATCGGACTCATTTTCCCAAATCTTACGGCTATCCTGGAAGCCAAAGGCGCCGCTGTCGCGCTCTATGGGCTGCTGGACA
CGCAATCTCACATTGATGCATCTCAGGCTGATGGAGTCGCTCCCGACTCGTGCTCGGGTCGGATTGAGGTTGTTAACGTCAGCTTTGCCTACCCAAGTCG
TCCGGACGCTCCCATTTTGAGAGACTACAGCGTCACCATTGAAAGCGGCCAGACGGTGGCGTTCGTGGGTGCGAGTGGTGGCGGGAAGAGCACCATTATC
TCGCTGCTGGAGAGGTTTTACGACCCGACAAGTGGGTCGATTCGGCTGGATGGGCGCGATATAAGGACACTCAGCGTGAAATGGCTCCGCTCTCAGATTG
GCCTGGTGTCGCAGGAGCCCGTGCTGTTTGCTACAACCATCGGAGAGAACATTGCTGCTGGTAGAGCTGACTTTACGCGCGAAGATGTCATCGCTGCGTC
GAAAATGGCCAACGCGCACTCATTCATCATGTCGTTACCCGAAAACTACGCCACTTTGGTGGGTGAGAAGGGTGTTTCGTTGTCTGGAGGCCAGAAGCAA
CGCGTAGCAATCGCTCGAGCTGTCATTCGCAAGCCCAAGATCTTGGTTCTCGATGAAGCGACGAGTGCGCTGGATGCTGAGAGCGAGCAGATCGTGCAGG
AGGCGCTGAACGAGCTCATGGCCAAGACAAGCATGACAACACTGGCCATAGCTCATCGGTTGAGTACGATTCGACACGCAGACAAGATCGTGGTGCTGGC
CGACGGCCATGTCGTCGAAGAAGGTCCTCACGACGAGCTGGTGGAAATTGAGCACGGCGTGTACCGCAACTTGTACACGATCCAGGAGACAAAAGCCCAG
GAAGAAGCGTCTCTAGCTTTGTCGGACACAGAATCAGAGCAGCAGAGCGGTGGTTTGGCTGCGGCTTTGGCACGAAAAGCAAGCAATCGGTCCATGAGAA
GTGATGGAGGCAGATACAGCGGCCATGCTGACGCTGGTGGCGAGTCAAGAGATCCTGCTCCGCGAAAATTTACGTTGAGAGACGCCAACGCCCTGAGCCA
GCCAGAGCGTGGGTATTTTATCCTGGGTATGGTCGGAGCTGCAGTCAACGGTGCCTCGTTTCCAGCGTCCGCTGTTCTTATCAGTGAGCTGGTGTCGATT
ATGACGACCGACTACGCTTACTATCAAGAATACGACGATCGATCGTACCTATCTTCCTTGCCGCACAGAGTGACAGTGTACGGATGTCTGTATATTGCTG
GAGCTGCGGTTCTGTTCCTCGGCCGTGCTGCTCAGAGCTACGGGTTTCAGTATATGGCGGAGACACTGACGGCTCGCCTCCGAGGGATCCACTTTTCGTC
TCTTTGCAGGCAAAACATTGGCTTCTTTGACAGGACTGAGAACGCGACCGGAGCGCTGACGGCTGACCTAGCGACAGACGCTCTGCGCGTCGCAGTGATC
TCTGGCGAGACTGAAGGACGATTGTTCCAAGCGATTTTCACGACGGTCGCGGCGCTCTTGATCTCGTTTCTGGCTGGGAGCTGGCTTCTCTCGCTCGTGA
TGCTTGCGATCATCCCATTCCTCGTGCTGGGAAACATGTTCCGAGGCAACAACATGCGCGGGAAAAGTATCCTAGCCGATGATATGGCCGAGGTTGGCGC
GCATGCGTCTGAAGTGCTGGGCAACATCCGGACGGTGGTGTCGCTGGGTCTCGAAAGCTCGTCCTGCGATAAATTCTCGGTGCTACTAGATGCCCCCATG
AAGAGCGGTGAGCGAGACGCACAAGTGAATGGCCTGGCAGTGGGCTTCAGCTCCTTTATTGTCTTTGCGACGTACGCTTTCGCCTTTTGGTACGGCGGGA
AACTGGTGGATGACGGATCGATTTCCTTCTTGCAGCTGATGCGCTCGCTCATGGCGATCATCATGTCGTCCATTACAGTTGGAGGCTCCATCGGGTATCT
CGCGGACACGGACAGCGCCTTTGAGGCTGGCGGGATCATCCTTTCGCTTCGAGACCGACCGCTACCCATCGACTCGTTCGGCGAGGAAGGTTTGCAGCCT
CACACCGTCGAAGGGAGAATCGAATTCAAGGACGTACTCTTCCGGTATCCGACAAGACCAGCGGTGACAGTACTGAAGAACTACAACCTCATTATCGAGC
CTGGAGAGACTGTCGCGTTCTGTGGACCCAGTGGCGGCGGCAAAAGTACGTGCGTGGCGCTACTCGAGCGATTCTATGATCCTATCCACGGCCAGGTTCT
GCTCGACGGAGTGGACTTGAAGCAGCTGAATGTGCGCTGGTTGCGGGGTCAACTTGGTCTCGTCGGACAAGAGCCGACGTTATTCATCGGCACGATAGCG
GAGAACATCGCGTACGGCCTCAATACCATGCCGAGCATGGCAGAGATCGAGACCGTGGCGAAAATGTCGAACGCGCATGACTTCATCATGCAATTCCCGG
ACGGCTACAGCACTCAGGTCGGAATGAAGGGCGAGCAGTTGTCGGGAGGCCAAAAGCAGAGGATCGCTATCGCTCGCGCCATGATCAAGAACCCCAGCAT
CTTGCTTCTGGACGAGGCGACGAGTGCTCTGGACTTGGAGAGCGAGAAGATCGTGCAGGAGGCGCTGGACAAAGTTGTGGCAAGCCAACGCCGCACGACC
ATCGTCATCGCGCACAGACTGTCGACGATTCGACACGCCGACAAGATCTGCGTGGTCAGTGGTGGCAAGATCTCCGAGCAGGGCACACATCAAGAACTGC
TAGGTCGTCGGGGGATGTACGCAAAGTTGGTGGAGACAGCCTCGTCGTAGGGA