Description :
From Genome Similarity Track
Location :
Scaffold_11:1045403- 1051434
Sequence
6031 bases(100 bases per row)
GTGTAAGCAAGTAACGGAGTAAATACCTGGCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCAACGACCAAGTTCGACATGAGCCAAGACCTCGACCA
CGCTGCCTTTCTCCATCTCACTCGGATCGAGTAGGAAGCTCTCCACCGCCTTGCGGCGGTGTCCGGAGAAGCCGTCGTCACGTCGCTGCTGCGCTCAGCG
ACGCCCGACGAGCAGCGCGTTGCGGCACAAGAATTCATGGAACGCGAGCTCGCCGATGCGAATCAACGAGTGTCAACTCCCTCGCGTATCTCCACGAATG
ACGTCGTGAAGCTAGAGACGTCCACCTACTCCGGTGCCGGAGGAGATCGACTTCCGCTGAATCGCTGTTTTCGAGAGATCGACATCGCCATCGCCTCGAG
GTTGATCGAGGCGCCTTCCGCGAAGGTCCATTTCCTCCTCTCGCGGCTGTCTGGGAAAGCCAAGGAATGGGCTCTCGGCAAGTTGGTTGTCGATCCCAAC
GTCTTCCCCACTCTGGATACCCTCCAGAGTGACCTTCGGCTCGCGTTCGAGCCGCCGCAAGATGAATTCCGAATTCGGGCAGACTTCTTCGCCCTTCGGC
AAGGCACGATGACTATGCGCGACTACGTCCAGAAGACACGACACCTCGCGTCGTGCATCGTGTCTAAGCCGATCGATATGGCCTCTCAGGTTCATGTATT
CGTGTTCGGTATGCGCGAAGGCATGACGCGCTACTGCCTTACAAGATCGGACCCCTCTACGCTCGAAGAGGCATTCGCCCTCGCCCTACGCGAGGACTAC
GTGGTTGCGGCGTCATATGCTCACGCGCTACCTGCTTCTGCTCGGGATTCTGCGCCCGAGCCCATGGACATCGACGCTATCGATGCGACGAGCAATCGTC
AGCGTTATGCAGCGCGTCGGAGCGGTGCTCGGAACAATCGTTCTCTCACCTGCTTCCGCTGTCGGAAGGTCGGTCATCGCGCGGCGGAGTGCCGCGCGCC
AGCTCCAGTGCTTGCGCATGTCGATGCCGAGCCCGTGAGTTCTGACCAGCCAAAAAACGGTCAGGGTCAGTAGGTGCGGGGCGCCCTACTGGCTGGAATG
GAGGTCCGGGTCCCCCGGTGGCAACCCAACCTCCTAGCCCTCCTGTGCTGCATGCACACTTTCATGCCACCACCACGCCGAGCGATTCAAGATTGATCAT
TGTCAGTCTTCATGTCGCCGGTGCCCGGCGACCACTGCGAGCGCTCCTTGATTCAGGAGCGACCAACAACTTCTTCCGCGCGTCGTGCTTGTCGGTACTC
CCGTCGGACATCACTGTCCGCAAAGGCAGAGGGAAGGTCGCTGTCAAGTTGGCCGATGGGAAATCACGCCGCGTAGCGCGGCGCGAGATTACCCTTCCGT
ACACGTTCGACGGTTTCCGAAGCAACGACGACTTCCTCGTCATTGAGATGAATTACGCGTTTGACTGCATCCTGGGTATGCCGTGGCTGACGCGCTATCA
ACCAGAGATTGACTGGTTGGCCCTGGTCGGTCAAGCGCCGCAGTGATTATGATGTGAGCGAGGTGTTCACGCACCTCGTGTTCGCCCAGAAGGATTGGGC
CTCACGTCACCGTCGTGGACCGGTCATCCACGACGCACGTTGTGCACAGAGTGAGCGATGGCCCTCTCTGCACGGCTTGCGCAGTGCTGTTAACTGACGA
GTCCCCGCGGCGCCGCGGGGATGAAGACAAACTGGCGGTCGAGCAGGGGCTCCCGCAGATGTACGAGACGGCGGTCGAGCAGGGGCTCCCGCAGATGTAC
GAGACGGCGGTCGAGCAGGGGCTCCCGCAGACGAATAAGATGGCGGTCGAGCAGGGGCTCCCGCAGACGAACGAGATGGCGGTCGAGCAGGGGCTCCCGC
AGACGAACGAGATGGCGGTCGAGCAGGGGCTCCCGTCAATTGAGCCGGTGGTCGAGCAGTTGGCGCTCCCGCTGAACACTACCGCGGTCGAGCAGGGGCT
CCCGCTAGAGGGGGGTGACATCTCGTCCAGCGAGAGTGACTCATCATTCTCGAGTTCGCACTCGAGGCGGCGAAAGAGGAAGTCGAAGCGGCGTCGGCTG
AAACCTCGCCGAGAGCCCGTACCAAGTGACAGCTCACCGACGGAGTCGGTCTGCGTGCTTGAGTATGTGGAAGGTACCTCTGGCCGCCGACGAACACTCG
AGCTTGCAAACCCGCCTGGCGAGGCAGGGTCGATCACTCGACTTCCAGGTCTCTCCTGGTAGAACTTCCTTCGCGGCCTCAAGGACGATGAAATCGAACA
GGTTTGCCTGATCACCGACGCCGATTCGGCGTCGCTCGAAGTGAATGCAGTCAGTGACGGCGACGCTCCCTCGCGCCCAAAGAGCGCTGAGCCGAAGTCG
GCCCGCGAGGAGCGCTTCGCAGCGCAGTCTTGGGACGCGCTACGCGAATCCGGCAATCCAGTCTACGAGACCGCCCGCGAATATGAAGATGTATTTCCGG
ATAAGATCCCAGCGGAGTTGCCAGCTGACCGAGGAATTCGCCACGATATTGATCTCGTGCCCGGCTCGAAGTATTGTGTGACGCGGCAGTGGCCGCTCCC
GCGAGATCAGGTCCAAGCTATCGATGACTTCTTCGAGAGCCGCCGCAAGGCGGGTCATGTGCGTGAGAGCACATCGCCGCACTCCAGTCCGACCTTCTGT
GTGAAGAAAGCCACGGGCGGATGGCGCATCGTCCATGCCTTCAACAAGCTAAACAACGCTACCATCCCTGCCCAGACGCCGATTCCTCGGAAGGACATGG
TGCTCGACGCAATGTCGGGTAGTGAGGTCTTCAGCGCCATCGACTTGACCGATGGGTTCTACCAAATCCTCATGAGGCTGAGCGATATACCGCTCACAGC
GGTAAGCACTCCCAGTGGTATGCTCTGGGAGTGGCTTGTTATGCCGCAAGGGTTGAAGAATGCTCCCGCCACGTTCAATCGCATGGTATCCCATGTGCTG
CGCCCGCTCCGCGACTTCGCACCGAGTTATTTCGATAACATCTTCGTACACAGTCGCGCTGAGGGAGGCCTCAGCGCGCTTGAAGTCCACTTGAAGCATC
TGAGGCAAGTCTTCCAAGTGATGTGCGAAAACAAGCTGTATGCCAACTTGAAGAAGTGTATATTCTGCGCGCCGGAGATTCCGGTGCTTGGCTGCTTTGT
GAGCAAGAACGGCGTCCGCGCCGACCCCGAGAAAGTGTCGTCGATATGTGCGTGGCCTACGCCACAGAATCCCACTGAACTGCGTCAGTGGCTGGGTCTC
GCAAATTATCTCCACAAGTACACGAAGAATTACGCCGGATTGATCCAGCCGCTCTCTTCGTTGTTGAAGAAAGATGTGTCGTGGTCGTGGACTTCCGCAC
ATCAAGCCGCCTTCGACTCGGTGAAGAAGAGTCTCGCCGAGGCCCCAATCCTCGCGCTCCCGGATGACTCGAAGCCTTTTCACGTCGTCTGCGACGCGAG
CGATTTCGCCATCGGCTGTGCGCTGATGCAATTCGATGAAGAAGATCGAGAGCGTGTCGTAAGCTACCAGTCTAGGCAGATGAAGCCGGCGGAGCGCAAC
TACCCTGTTCACGACAAGGAGCTCCTTGCGATGCGCTACGCTCTGATCAAGTTCAGAGTGTACTTGTTGGGTGAGGACACCTTCGCGGTGTACACCGATC
ATGCATCGCTGAGGACAGCGATGAAGAGTCCTCATCTCTCCCAGCGGATGGCCCGCTGGCTTTCGTTCTTCTCCGAGTACAACTTCGTTGTCCACTACAA
ACCCGGCAAGAACAACATTCTCGCCGACGCTTTGTCTCGGCGTCCCGACTACGACCCACGCGGTGCATTGGGTCGACAAGCTTCGCTGGATGAAGACGAT
GTAGACGAGTGTGCCACGTGCGAGGCGTCAGGCGTCAACCTGACGAGCGTCTCCCCGGTAATGCCACTTCGCGACGAGATCCGAGCTGCTTACGAACATG
ACTCGACGTGCTCCAGTATCCTGAAGCATCTCCGCTCTCCCAGCACCGACACACTGGGAGCCCTTTCCCGCTCTGGACGAAACAAAATCCACCGATATCG
TCTCGAGGACGAGCTGCTGACGTACAGCATCGACAACTTCGATGCCCCACGTATCGTTGTTCCTAACGACCCCGATCTGCGCTCACGGATTATCCATGAG
TTTCATGATGCCCCGCTGGGCGCTCATCTCGGTCGCGAGAAGACATTTGCCGCTGTGTCACGCGACTTTTATTGGCCACACCTGTACAAATGGGTGCGTA
AGTGGGTGCGCACCTGCGAGACCTGCCAGCGCGTCAAACCTGCCTCGTCTTCGCAGGCTCCCTTGCGTCCTCTACCGGTGGCCACCGAGGCCTGGCGCTC
GGTGTCGATGGACTTCATCTTCGGGCTCCCACCCGATGCTAAAGGACGATCAGGTGTCTTTGTATTCGTAGACCGCTTCAGCAAGATGGTCACCTGATTC
CCGGTGTCGGATGCGATCACCGCGGCAGATACCGCGGTGCACCTCCTCGATGCTGTCTTCCGTCATCATGGCCTTCCCGAATCTATCGTCTCCGACCGCG
ACCCGCGCTTCACGTCGGCCTTCTGGTCAAAGCTCTTCGAGCTACTGGGCTCGAAGCTAATGATGTCCACAGCAGCCCATCCGGAAACGGACGGCCAGAC
GGAGCGCGTAAATCGCGTCCTCGAAGACGTCCTTCGAAGCTACGCGACGTCGTTCTCCAGCTGGAGCTCGTTTCTGCCACTGGCCGAGTTCGCTCTGAAC
AACGCGGTACACGCGTCGACTGGGCTGACGCCCTTCTTCGTTAATAACGCGCGACACCCGCGTGTCCCTGCTCTCCTCGCCGTGGGCCATCCCACAGCGC
CGCGTGTCTCCACTCTGGGTGGGGAAGAAGCTGCCGACAGAGCGTCTACTCCATCTGCGATGTCTCCGGCGGCTACACCGGTACTGGGTCAACCGGTACA
TACACCGGTTGCTAATGATATCTCGAGTGTATCCCCTGTTCCCACGTCGGTCAACGCAGTGACACGCTCCGCATCGAGCTCACTTGCGCCAGCTAACTAC
GCGCCGAAGCATGCGGCGCGACCAATCGACTCCGCAGTCGTCTCCGACTTCGTACTACAGCGCCAAGCGGTCACCCGCTATGTTCGAGACGCACTGCAGG
ATGCAGTGGACAAGCAGAAGGAGAACGCCGATAGGATCGGTCGCAAGAACACGGCCACGTTTACGACAGGCGAACGCGTGCTCCTGTCGACTGAAGGTAT
CAGAAACTCTGCGGTTACCAACCTCGGCGCGAACAAACTCGCGCCGCGCTTTATTGGGCCATTTACGGTAATCAAAGCCATTGGTGATGCCTACACGCTT
GACATTCCTACGTCACTACGTCTGCATCCGACGTTTTACGTCGGACGGCTCAAGAAGTATCACCCCGCTACGATTCCAGAGTCGTCTCAGGCTACTGAGC
CGGAGCATGCGTCGAGCGACCTTCTCGACGGGCGCGGCGAGCCATCAACCCATCCGCACCAGGAGTCGGATCTCGAGGCTGCGTCCCCGTCTGCAAACGT
CCGTGAGCCGACCTCTCCAGCATCTGCAACCGAGCAAGGATCTCTCGGTTCGACTGACGCAGCTGCGCACTCTCCCCGGTGGCCCGGGCAGTCTGATCGA
GAGCCTCATCCAACTCCTGCTGGACATCCCAGTAGCTGTTCAGCAAGTCGTTCTCGCTCTGGGCAGCCAGAGCGCGAGTGCTATCGACGCGACGGCCCTC
CTCCTGTTGTTGACGCTGCCGGAGATACCCGCTGGATTGTTGAGTACATCGTTGCCCACGAAGATCCACTTCGCGCTCCCAAACGTCATCGTGGGCTCGC
CCACGATGTTCCAGCCGACCGTCGCTATCGGGTACGTTGGCTCGGGTTTCCTCCCGACGAGGATACGTGGGAGCCTCGCGCCAATCTCCTTCGGGACGTC
CCGAATGTGGTCCAGGCGTATGAGTCCAGCC