Description :
From Genome Similarity Track
Location :
Scaffold_426:10453- 12285
Sequence
1832 bases(100 bases per row)
CATCTGATCGCTTCCGTGTGAGGTAATATTACCTAGCCACAGACACCCCTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGAATTATTTC
AGCTCCGTCATCGCTGACACACGAATACATTGGGGAATTCCACCNNNNNNNNNNACTGAATATATTAAGCTCCTTCATCGCTGACACACGAATACGTTAA
GGAACTCCACCACCATTCTGCAACGTTTCTGCGGTGGATACCAACGCACGTCTCCGATCTTCTTGCTCCGAAAAATCGGGATCGATATCTTCATGATCGA
GAATNNNNNNNNNNATCGCGCAGAACGCCGACTTGACATTGCTGATCCAACTTCTGGTCCGACTTTCATCTCTATANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTCAACTTCTGGTCCGATCTTCATCTCTATCTTTGTCACTGAATTATTATAGCTCCGTTATCGCTAACNNNNNNNNNNGTCCG
ATCGACTGCGATGCGATCGGAACTATTTCATCTCGAAATCTAGGGTGCATGTTCTTGAACTCTTGGAGTCTTGATTCTTTTGCTAGGATAGATTGCTTGA
TACGCTTGCTCGATTTGTTCTTGTTGAAAACGTCCCATAGCATCTTCGAGGNNNNNNNNNNACCACTATTCTGCAACGTTCTGCGGTGGCCACCATCGCA
AGTCTCCGCTCTTCTTGACCCNNNNNNNNNNCTGATGATTTGGCTATGGTAGATCGCTTGATACGCTCGCTCTTTTTGTTTTTGTTGGAAACGTTCCATG
GCCTATCCGAGGTACGCCTGCAAGTGTCATTGCGTAGTCAAATTCGTCTCTCCTTTAGCACATGCGGTCGTCGATCTAGATGATNNNNNNNNNNCTTCTT
GAGATCTCGCAGTCTTGATCCTTGGCTATGGTAGAGCGCTTGATACGCTTGCTCCAGCTGTTCTTGTTGAAAAAGTTCCTGGGCCTCCTCAAGATAAGCC
TACAGGTGTCGTTGCGTAGTCAAGTTCGTCTCTCCTTTAGCACGTGCGGTCATCGATCGTGGTTCGATTTGATCATTTCAACTCTATCGCGCAGGTTTGC
CGCCCCACTAATGCCTAGAGATATCCGCTGAATGCCGATCATATCATCAGACTCGGTTTCAGATTTAGCTGAGGCTTACTGCAACGATCCGGTGAGATAT
CCTCTCGGGCGTCTGCGATCACTGTGTCCGCTTGATCCGTAGGATCGCACTTACCCTTCAGGGGAATTAATTTTCATATACTGATCAAAACGCGTGGGTC
ACCTGATCTTGTTCGNNNNNNNNNNTGATCGCACTTAACCTTCAAGGAAAGTACTTTTCATATAGTGATCAAAACGCTTGGGTCACCTGATCTTGTTCGC
ACTCCAGCNNNNNNNNNNCCGCAGGTGTCTTTGTATAGTTGACGTCATCTGTCCTTTAGCGCATGTGATCGTCAGTTGCGGTTCGATCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCGCTGCTTTCGTTTGATTCGTAGGATCACAATTATCCGATAA
GAAGGTTAACTTGTCGTATNNNNNNNNNNTTC