Description :
From Genome Similarity Track
Location :
Scaffold_220:10450- 11690
Sequence
439 bases(100 bases per row)
ATCATTATTTGGCTTTTCTTCACGACATTCGCGGCACTAGAAATGTGAACGGGACACAATCGCCCTAACAGCCACCGCTTTCCAAAAATTACTACATTAA
ATAAATGTGCAGCATTTATCTGTCAGCCTCTTTGTCACATACATGTCACCAGTGTGGCTGTACGAGTGCACGGCGGCAGGCATCGTCTTGCCAAGGTCAA
GCTGTGGTTTTGACGTATGGGGACGCAAACCCAATGCGATCGTATTGCATAGACAACGGCCTCGTAACTGACAGATAAAATGTTGCACAATTATTCAATT
TTTTCGCTAAATGCGGCGTTTGCGCAGCGGGGCGGCTTCTGCATCGCTACGATGCACTCTGTGGGGCCGGCACTATGATCTACACCATCGCTCGCGATCT
GTAGCCTTCTCCAACACTGTGCCTGCCGCCGTCGAAGTC