Description :
From Genome Similarity Track
Location :
contig_58:1045- 5425
Transcript NameFunction/comments
g8826.t1conserved hypothetical protein
g8827.t1hypothetical protein

Sequence
4380 bases(100 bases per row)
GGACAATGTTGAAGAGCGTACGGCCAACAATGCGAGGGAGGAAATTGCGTAGGTGATGGACAATATGACTAGCAGTGCAGAGCTTTAGGTTAGGCTTGAG
AGCTGCACGGACAGAGAATAACTTTGTTCATTAATCAACTTTCCTCTGTGGAACAAGACCCCAGGTATTCGCGACAAAGCTAGCCTTGCGCTCTTCGAAG
CGTTAGTTTTTTTATCCCGGATACTGCTGTGTCACTTCAGTGCGCGTGTCGACCGAAGGTTCCACAAAATACCGATCTACGCCGACTAAGTATGATCTTG
CTAAGTTCGTCTTAAGTGCGCTTGAAATGAACTTCAACTATACCCGGCTTCACGGTGGAATCCGACTGCGATGTGGAGATGACGATTCCGGATCCGATCT
TCTAACTGACCAAGGCCCCGGACCTGCGTAGCTGGGAGCATGTTGCGCTAATTGAGTGGTACCTCGAGTGGGAGCGCAACGTGGAGAAGATTCGCAACCG
CTGTGGCGTCACCAACGAGACGTTCGAGAGCGTCGTGACCACCGTCAAGAGTTCGGTGAGATCCAATATGCATAGGAACATAGCTACCTATGTGCTGAAG
ATGCCACTGTCCTCAGTCACCGACGCTGATATCATGGAAGCCGTGCAGGGACGTTGCCGTACTGTCAAGAACGAGTTTATGCCCGATGTCACGTCTTTGT
TCCGTCAACAGCTGAAGATGGATCTGTCTATTGACGCCTGTGACGCCTGAATCTTCCGTTACTATCAAGTCTTCAACAGAATCGTGGAAGACAATGGTCT
ACAAGGTCTGATTGGCCCCGGGAACGAGTCTGATACTGGCTAAAACAGTCGATTGAAGGCTCGTTGCCGTATACTGGTCGACAGTCTACAACCTCCTGTT
CTCAAGGCTCAGATCACTCGACTGATCGATTTAGAGAAGAAAGACTGCAAATCGGACGATGTTGCCTTCTTCGATCTAATACTGGGACATGCGAAAGTAC
AACAGCAATTCCGTCGCATGTCGCAAGATTATGTTAAGAGGGGGGATTCCAAGTCAGAACAGAGGCCACAACGGGTAGAAGCCACCAAGACAACGCCGAC
ACGTAGTTCACCGCATGCTGTCTCACCGCCTCCAATCCATGGACGGACTCCACGACCTTCGCGCCCTCTGCCTCAAGAAAGAATAATGCATCCCGGTGCG
CTTGTGCTGTAGTTCCTGTGCGCAAGCCGGGGACTCATGATAAGTTTCGTTTGACCATTGACTATAGGCCAGTGAATCGAGTCACTATTCCAATCACCGG
GTCGATACCGACCAATGCTACCACGACCGATGCCTTTGGAGGCAAAAAAGTGTTTGGATCATTCGACTTCACCCAGAATTTTGACAGCTGCCGTTGCACG
AAGCGAGCAGGGAGATATTTTCCTTCATTACCGAGGATGGCGTGTTCACGCCAAACAGAGCCCCACAGGGAGCAATCGATTCGAGTTTGTATTTCCCAAT
CTGGATGACATTCGTGAGGTGCAACGTGTGACTGGTTAAGAAAAATTGCGTCTGCGAGTCACTCTCAGGGAGGGGGACGAGTGGAAGGCCGGTCATCGAT
CCCGAATAAGGCTAGAGAGTTCCTCGCACGGATTTTTGTGGTGGCTCACGCTGGTGCACAAGGACACTGAGGCCAGGAGCCGATGGTTACATTGCTGCAA
AGACACTTCAGGATTGCTCGTGTCAACGAAAAAGTATCTGTATTTATTCGCCGATGCTTGCTTTGCAAGCACCGCAAGGGCTCACGTGTAATGGTCTGCT
TAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAA
ACCTAGATAAATGAACCAAACGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTT
CTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTG
GACCACCCTGTGGTGGTCACCTGAATGTATCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACCATCCCCCCGTTA
GGATTTGACGTGCCGGTCTCGACACGTCAATCCGTATTTTCTTCGGGAGAACACGTGCTCATTCCCAATGAGCACGCCAACGACGTCTTCGTCCAAGACG
CCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTCCAAGGCGACGACGGCCGCTGCCTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCGATGC
CGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCTGGATACCACTCGAGATGGCATGAGAAACATGCCATCCGAAACAAGACAGGCAAGATCATTGC
TGTCGAAACCGGAGTGGGCATCTACTCTCCGGGTGGAGAGGGAGTTCCCCTCGACTACGGAAGCGAAGTCGAGGAGGGGGAACTCGAAGGAGACAAGGAC
ACCTTGTCTCCGGGCCACACTGACCCCAATGTGGGTCTACGTCGTCCACGCGAGGACGACCGAACGCTTCGAGCTCGAAGCGTTCGCGCAGCGGCAGTGG
AACACCGCTCGCTGCCGCTGGAGCCTTACGACTCCGCGGGATGGAGATGACTCTGCTCCATCCGCTGTTGTTGCGGCCTCGCGCACTGAGCCAGTGCGCG
AGCCGTGGATGCCGTCTCAGTCTGAGATCGGCAGCCGATTCGGTGCGACCGCGCCACCGAATCTGTACGCGCTGTATTCGTGCAACGCCATCGTTGACGA
TGACGTCGCGAAGCGATACACTTTGATCCGTTAACGAATCAAAGGCGCGACTACTACATCGGGCTCTTCCATGAGCTCCGATGGTTTGCGAGCAAGAAGA
CTTCTCGCAGAAGCAAAGTGCCCGAGTGGCAGGCACTTTGTCAAAGTTGGAGTGCCTTTGTTGAAAACTTCAACAAGAACCCCGCTGGCTATCGCGACCG
GATTAGCCAGGCGCGGGAGCGCTACGAGAAATTCTCGAAGCGTGGTAAACTTGAACGACTGCACCATGGTGCAGTCGGTATTGGACTTCCTTGCGCAGTG
CCTTATGACACTGCTTGTGAGTACTGCTACCCCGGAGCAGTACGCATCACCGAGCGGGACGTCAACGGGTACACGTCCATGTGTGTACCTGACGACCTCA
AGACCCTGCGCGCCAGTTTTCAGGCGCAGGCGTCTTCTAGTGCTGCGGATAATCGCAGCACTTATCCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAG
TTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGTCCTCCATCAAGACATTCCGTGATTCCCACGTATCGT
GTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCGGACCTCGGGTCTGGTTCCGATGACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCC
GCGTGCGTCTCGCAACGGGGGTGGGGGGGGGCGGAAGACGCCCCGGGTTTGGTCAACCAAACCTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGC
GTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTAAAGGCTCAGCTCGCGGAGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACG
AGACTCTCTGGCGTCTCGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAGTCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCC
AACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGA
GCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCC
TGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCAT
TGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTC
GTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGC