Description :
From Genome Similarity Track
Location :
contig_58:1045- 5422
Transcript NameFunction/comments
g10390.t1hypothetical protein
g10391.t1hypothetical protein

Sequence
4377 bases(100 bases per row)
GAGGACAATGTTGAAGAGCGTACGGCCAACAATGCGAGGGAGGAAATTGCGTAGGTGATGGACAATATGACTAGCAGTGCAGAGCTTTAGGTTAGGCTTG
AGAGCTGCACGGACAGAGAATAACTTTGTTCATTAATCAACTTTCCTCTGTGGAACAAGACCCCAGGTATTCGCGACAAAGCTAGCCTTGCGCTCTTCGA
AGCGTTAGTTTTTTTATCCCGGATACTGCTGTGTCACTTCAGTGCGCGTGTCGACCGAAGGTTCCACAAGAATACCGATCTACGCCGACTAAGTATGATC
TTGCTAAGTTCGTCTTAAGTGCGCTTGAAATGAACTTCAACTATACCCGGCTTCACGGTGGAATCCGACTGCGATGTGGAGATGACGATTCCGGATCCGA
TCTTCTAACTGACCAAGGCCCCGGACCTGCGTAGCTGGGAGCATGTTGCGCTAATTGAGTGGTACCTCGAGTGGGAGCGCAACGTGGAGAAGATTCGCAA
CCGCTGTGGCGTCACCAACGAGACGTTCGAGAGCGTCGTGACCACCGTCAAGAGTTCGGTGAGATCCAATATGCATAGGAACATAGCTACCTATGTGCTG
AAGATGCCACTGTCCTCAGTCACCGACGCTGATATCATGGAAGCCGTGCAGGGACGTTGCCGTACTGTCAAGAACGAGTTTATGCCCGATGTCACGTCTT
TGTTCCGTCAACAGCTGAAGATGGATCTGTCTATTGACGCCTGTGACGCCTGAATCTTCCGTTACTATCAAGTCTTCAACAGAATCGTGGAAGACAATGG
TCTACAAGGTCTGATTGGCCCCGGGAACGAGTCTGATACTGGCTAAAACAGTCGATTGAAGGCTCGTTGCCGTATACTGGTCGACAGTCTACAACCTCCT
GTTCTCAAGGCTCAGATCACTCGACTGATCGATTTAGAGAAGAAAGACTGCAAATCGGACGATGTTGCCTTCTTCGATCTAATACTGGGACATGCGAAAG
TACAACAGCAATTCCGTCGCATGTCGCAAGATTATGTTAAGAGGGGGGATTCCAAGTCAGAACAGAGGCCACAACGGGTAGAAGCCACCAAGACAACGCC
GACACGTAGTTCACCGCATGCTGTCTCACCGCCTCCAATCCATGGACGGACTCCACGACCTTCGCGCCCTCTGCCTCAAGAAAGAATAATGCATCCCGGT
GCGCTTGTGCTGTAGTTCCTGTGCGCAAGCCGGGGACTCATGATAAGTTTCGTTTGACCATTGACTATAGGCCAGTGAATCGAGTCACTATTCCAATCAC
CGGGTCGATACCGACCAATGCTACCACGACCGATGCCTTTGGAGGCAAAAAAGTGTTTGGATCATTCGACTTCACCCAGAATTTTGACAGCTGCCGTTGC
ACGAAGCGAGCAGGGAGATATTTTCCTTCATTACCGAGGATGGCGTGTTCACGCCAAACAGAGCCCCACAGGGAGCAATCGATTCGAGTTTGTATTTCCC
AATCTGGATGACATTCGTGAGGTGCAACGTGTGACTGGTTAAGAAAAATTGCGTCTGCGAGTCACTCTCAGGGAGGGGGACGAGTGGAAGGCCGGTCATC
GATCCCGAATAAGGCTAGAGAGTTCCTCGCACGGATTTTTGTGGTGGCTCACGCTGGTGCACAAGGACACTGAGGCCAGGAGCCGATGGTTACATTGCTG
CAAAGACACTTCAGGATTGCTCGTGTCAACGAAAAAGTATCTGTATTTATTCGCCGATGCTTGCTTTGCAAGCACCGCAAGGGCTCACGTGTAATGGGTC
TGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAGTTTACTTAAGTTCAGTATACTTGTATCCACAAGTATAC
TTAAACCTAGATAAATGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAGCTGATATTTCTAATGAG
AGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGA
ATGTGGACCACCCTGTGGTGGTCACCCGAATGTATTCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACCATCCCC
CCGTTAGGATTTGACGTGCCGGTCTCGACACGTCAATCCGTATTTTCTTCGGGAGAACACGTGCTCATTCCCAATGAGCACGCCAACGACGTCTTCGTCC
AAGACGCCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTCCAAGGCGACGACGGCCGCTGCCTCAGCCACGACCGCTACTGGCATCGCCTCGACGG
CGATGCCGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCTGGATACCACTCGAGATGGCATGAGAAACATGCCATCCGAAACAAGACAGGCAAGAT
CATTGCTGTCGAAACCGGAGTGGGCATCTACTCTCCGGGTGGAGAGGGAGTTCCCCTCGACTACGGAAGCGAAGTCGAGGAGGGGGAACTCGAAGGAGAC
AAGGACACCTTGTCTCCGGGCCACACTGACCCCAATGTGGGTCTACGTCGTCCACGCGAGGACGACCGAACGCTTCGAGCTCGAAGCGTTCGCGCAGCGG
CAGTGGAACACCGCTCGCTGCCGCTGGAGCCTTACGACTCCGCGGGATGGAGATGACTCTGCTCCATCCGCTGTTGTTGCGGCCTCGCGCACTGAGCCAG
TGCGCGAGCCGTGGATGCCGTCTCAGTCTGAGATCGGCAGCCGATTCGGTGCGACCGCGCCACCGAATCTGTACGCGCTGTATTCGTGCAACGCCATCGT
TGACGATGACGTCGCGAAGCGATACACTTTGATCCGTTAACGAATCAAAGGCGCGACTACTACATCGGGCTCTTCCATGAGCTCCGATGGTTTGCGAGCA
AGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCAGGCACTTTGTCAAAGTTGGAGTGCCTTTGTTGAAAACTTCAACAAGAACCCCGCTGGCTATCG
CGACCGGATTAGCCAGGCGCGGGAGCGCTACGAGAAATTCTCGAAGCGTGGTAAACTTGAACGACTGCACCATGGTGCAGTCGGTATTGGACTTCCTTGC
GCAGTGCCTTATGACACTGCTTGTGAGTACTGCTACCCCGGAGCAGTACGCATCACCGAGCGGGACGTCAACGGGTACACGTCCATGTGTGTACCTGACG
ACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCAGGCGTCTTCTAGTGCTGCGGATAATCGCAGCACTTATCCGAGTGCTGTAGGCGACTACAGCGCTCG
CCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGTCCTCCATCAAGACATTCCGTGATTCCCACG
TATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCGGACCTCGGGTCTGGTTCCGATGACCAACAATTCGCTGGACGATCCAGCGAGT
TGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGGGGCGGAAGACGCCCCGGGTTTGGTCAACCAAACCTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCT
CCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTAAAGGCTCAGCTCGCGGAGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTC
GGGACGAGACTCTCTGGCGTCTCGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAGTCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAG
TCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAG
CGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGT
TTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAA
GTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACG
CCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCT