Description :
From Genome Similarity Track
Location :
Scaffold_15:104474- 107664
Transcript NameFunction/comments
Hyaar_Emoy2802777hypothetical protein

Sequence
3190 bases(100 bases per row)
GTAGGTAAGCCTTAAGGCGACTGACATAGAACGTCGGGTGAAAGTGGATAGTGGTAGGTATATCTAGCGTGTAAGCATCTTCAATGTTTCCTTAACAACC
CGAAAGTGACCAATATATGTTGGCGCTAATTCTTAGCGCCCAAAGCGTCGATGACAAGACTTTGTCACCTTCTTTGATGGTCAGCGTGTTCTTTCGACCT
CACTTGTCAGCGTTCTCCTTTTGTTTACCCACTACCTCTTGAAGGGCATCACATACAAAACTCTTGATGCCTTGTCGTAGTAATAGGAATTCGGTCACAG
CAGCCAAACTTACAGGTGAAGTGGACTCTTTAGGAGCAAAATTAGCAACGGGAGACGCGATAGGATGCATCGCGTCGGGAACTCGATATCTCATTGGCCA
CGTAGTTAACTGCATAATTTGTATCGGCAGCAACCTCATCTTCAACATAATCAATCATCAATTTGTTTGGCGTAATGCCATCGGCAGATACTCTCCCACC
GAGCTTAGAAACCGGATGTTCTGAAGCTGAAAGAGCAAGAAGCGTTAAAACGCGAGGGTGCCTTGCGTTGTTCACGAAGGATGGCGTCAACCCTGTTGAC
ACGTGGACTGCATAGTTAATTGCAAATTCAGCGAGTGAGAGAAATGAACTCCACGACGTAAACGATGTCGCATAACGGAGCAGGATATCTTCAAGCACTC
TGTTCACGCGCTCCGTTTGCCCATCCGTCTCTGGATGGGCTGCCGTTGATATAAGCAATCGCGTGCCCAATAGTTGAAACAACTCTGCCCAAAACGCCGA
CGTGAAATGCGGGTAACGGTCCGAAACAATGGATTCTGGCAAGCCGTGGTGCCTGAATATAAGATCGAGAAATATCTTCGCGGTCGTCTCCGCCGTAACG
TGTGCGAAGACTGGAGCAAAACGCACCATTTTACTAAATCGATCCACAAGAACCATTACGCCCGTGCGTTTCTCTTCATCTGGTGGAAGACCAAATATGA
AATCCATGCTTACCGAACGCCAGGCTTCCGTGGCAATCGGAAGCGGTCGAAATGGGGTTTGTGAAGACGGTGCAGGCTTCACACGATGGCATGTTTTACA
GGAGCGTATCTATTTCTGGATACTTGTACATACTCGGCCATAAAGATACACGAGAAATGGCCACGAACATCTTTTTGCGACCCAGATGACCACCAGCTGG
AGTGTCATAAAATTCATGCACCAATCGTGCTCGTAGGTCGTCATCAGCAAGGATGACGACGCGCGGTGGGTCAAAGACGTCCATCGTATACATCAGCAGC
GGACCATCAAGCGCGTAACGCTTGATGTTGTAGCGCTTTGGTTTCGTCAACTTCGCGAGTGACCCCCCACTAGGGTGTTGAAGGTAATTGATAATTCCCG
TGTAAAAAGAATTATTCGCATATGAATCAGCGATCTGAGTCCGAATTGACAGCACAGGTGTAGAAATCATCGCATTAAGCCCCAGCAGAGCACAGCATAA
ACAAATGTCATCGTCTTCGTCATCAGCACTGCCTGTATGATGACCCATGTCACGACGAGGATCATAATCGGGACATCAAGAAAGAATGTCATCAAGAATT
TTATCCTTGCCGGTTTGTGAAAGACCACGAAATTATACTCTGAGAAATATGACAATCAACGTGTCATACGCTGGGACAAGTGGGGAGTCTCGACGGCGGT
ACGCAATGATGCGTGATCTGTATAGACCGAAAACATCTTCTCGCCGAGCAAATTACTCTGAACTTGATCAGTGCGTAACGCATAGCCACAAGTTCCTTGT
CATGTTCCAGATGATTTCTTTCTACAGGTTTCATCTGCCGTGACTGAAAGCTCACGACGCGCTCTCGGCCCTCATCGTCAAACTGCACGATGGCAATCCG
ATTGCAAAATTACTCGCATCACAGACGACGTGAAATGGCTTGGAGTCATCAGGCAACATTAGCACTGTTCCCTCAGACAAGCTCTTTTTCACGGAGTCGA
AGTCAGACTGATTTTCTGCCTTCCATGACCAAACTGCGTCTTTCTTCAACAGTGTCGATAGTGGCGGAATTAGCTCGGCATAGTTCTTCGTATACTTATG
CAAATAATTAGCAAAACCAATCCATTGACGTAGTTCAGTTTGGTTCCTGAAGGCAGGCCAGAAAAATATCGACGACACTTTCTCGGGATCAGCACGGACA
CCTTCCTTGCTAACATAGCATCCGAGTACTGGAATCTCGGGAGCACAGAAGACACACTCCTTTAAATTTGCGTAAAATTTGTTCTTGCGCATAACTTGAA
ACAGCTTTTTCAAGTGCCGAATGTGAACCTCCGTAGCGCTGAGATGTTGCTCAGCGTGGCTGTGAACAAAACTACCGTCGACGTAACCTGGCGCAAAATC
GCGTAGCGGTTGAAGCACTTGTGTCACCATCCGTTCGAACGTTTCTGGAGCAATCTTAAGGACTGGTGGTATGATGAGCCACTTCCAAAGCATCCCGCTT
GGGGTGCTAATAGTATTGAACGGAATATCACTTTCCCTCATGAGGATCTGATAAACCCATCTGTCAGATCTACGGCGCTGAAAATATCGCTGCCGGACAT
GGTATCCAATACCATATCTGTGTGGAATCAGCGTTTGAGCTGGGATCGTGGCGTCATTCAACTTGTTAAAAGCATGCACAATGCTCCAACCACCAGTGGC
TTTCTTCACACAGAAAGTCAGAATCGAAAGTGGCAAGATACTTTCGAGAACATGGCCTGCCTTACGGCGGCCCTCAAAAGATTCATCAATTGCGATGACT
TAATCACGCGGTAACGGCCACTACCGCTTTTCGCAATAATTCGATCCTGGCACAAGATCGATCTCGTGCCGCACTCCACCATTCACTGGAAGCTCAGTGG
GAATTTTAGCTGGAAAGATATCGGCATACTCGCGAGCGATATCGTAGACAGGGTTGCCCGAAGAAAGAAGGTCTTCCCAAGACTGTGCCGCGAAACGTTC
TTCACGCGCTGATTTGGTCTCGGCGCTCTTTGGGCAAGCCCCCAAAAATTCTTCACTAGCTGCCTTGGTGGCTAAAACGATGCACAGTTGCTCGATATCG
CCGGCCTTTAGGTCGTGAAGGAAATGCTATCAAGGTAGGGCTGATAGAGATCTAATCTCTATAGCAGTGCACGGAGGGCTCGCTACCTCA