Description :
From Genome Similarity Track
Location :
Scaffold_283:10447- 11894
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_283-snap-gene-0.21Nucleolin

Sequence
1447 bases(100 bases per row)
CCACCGCCGCCGCGGCCACCACCACGGCCACCGAAGCCACGGCCACCGCCACGGCCACCGCCATCGAAGCGACCGCCACCACGGCCGCCACGGCCACCAC
CATCGAAGCGGCCACCACCGCGACCACCACGGCCACCGCCGTTCGAGAAGTTGTCACGGCTCTTGGCGTACGTGACGCGGATCGCACGACCGTTGACGTA
CTCGCCCGCGAGCTTGATGGCCTCGTCGACAGCCTCGGTCGTCTCGAAGTCAATGTGGCCGAAGCCGCGGAACTCGCCCGTCTCACGGTCCGTCGCAAGA
CGGACGCTCGCGATCTCACCGCACTCGCCGAACGTCGCGCGGATCGTGTCTTCATCCACATCCCACGACAAGTTGCCGACGAAGATGCCGACGCAGCCCT
CCGGCTTCTCCTCGAACTGGTTCTTCTTCTCGGCCGTGCGAATCTTCATCCACCGGCCGCCAAAGTCCTGGCCGTCCATGGCGAGCGCCGCCTCGGCACC
CTCAGCCGTCTCGAACTTGATGAAGGCAGTGCCCGACGAGCGGCCGTTCTGCATCACAATGTGCGCGTTCGTGATCTCACCGCAGCCGGCAAAGTGCTCC
GACAGCTGCTCATCCGTGGCCGACCACGGCAGACCGGCGATAAAGATCTCAGTCGTCTGCTGCGGGTTGGCGACAGCCGCACCCTCGCCGTTCTCCTGCT
TGTGCACCTTGACGCTGTTGCCAGCCTCGCCCGCGTCCGAGTTCTTGCGCTTCTTGGATACAATCGCAGGCTGCTCGTCCTCCTCATCCGACGAGTCGTC
CGACGAGCTGTCCGACGACGACTCCTTCTTGGCAGCAGCCTTCTTCGCAGGCGCAGCCTTGGCCTTCGGGGCCTCCTCCTCATCCGACGAGTCGTCCGAA
GAGCTGTCAGAGGACTCCTCCTTCTTCGCGGCCACCTTCTTGGCAGGCGCAGCCTTGGCCTTCGGGGCCTCCTCCTCGTCCGACGAATCATCCGACGAAG
AGTCCGACGACTCGGACTTCTTAGCAGCCACCTTCTTGGCAGGAGCAGCCTTCTTCGGCGCCTCCTCGTCCGACGAGTCGTCCGACGAAGAGTCCGAGGA
CTCAGCCTTCTTGGCCACCGGCTTCTTGGCAGCGGCAGCCTTGGCCTTCGGGGCCTCCTCCTCGTCCGAGGACGAGTCAGTCGAAGAGCTGTCCGAGCTG
GCGGCGGCCTTCTTCACCGGCGCCTTCTTGGCAGGAGCAGCCTTCTTGGCCGCGACCGGCTTGGCCGTCTCCTCCTCATCCGACGACGAGTCCGAGTCCG
ACGACGAGCTCTCGGCCTTCTTGGCCGCGACCTTCTTCGTGGCCACGACCTTCTTGGTCACGACCTGCTCGTCGCTGCTCGAGTCCGACGAGCTGTCGCT
GCTGGACGCCGGCTTGGCCACCACGGGAGCCTTGACCTTCTTCGCCA