Description :
From Genome Similarity Track
Location :
Scaffold_109:104459- 106023
Transcript NameFunction/comments
g12038.t1GAY05304.1 pleiotropic drug resistance protein ABC superfamily [Pythium insidiosum

Sequence
1564 bases(100 bases per row)
CTTTGCCATCCCTGGTGGGAGTGCTGCCTGGTACTTGTACTGCTGGTTTGTGCCCAGGTCCAGCAAATAGTCAGCCACGTCACGGCCATGAGGGCACTTG
AAGCCGAGCGACTCGAAATACGGGACCACCTTGTGGCGAGGCCCATTGTACATCATCTCGCCTTCGTTCATGATGAGGATGCTGTCGAACAGCTCAAACA
CCTCCGGCGCAGGCTGCAGCAACGCGATGACGATGGTTCGATGCATGTTCTTGGCGATGCTGCGCTGCGTCTTGATGATGTCGTACGTCGCCGCACTATC
CAGTCCAGTGCTGATCTCGTCCATGAGGGTCATGTACTTCTGGCCAAACTGCATCTCGCCAGTCGTCACACGCTTGCGTTCCCCACCAGACACACCGCGG
TGCATTGCGTTACCAATCACCGTATCCTGGCAGATCTGCAGCCCGAGCTGCTCAATGATCACGTCAGGGAACCTGGAGAAGACGGCCTTCGCAGCAGCCA
GCGCTCTCGCGTTCGCCTCGGGGGTGCCTCTCGACAGCATCTCCTCGCCGTGTTTCGACAGCCCACCACCACAGAAAGCGTACGCGAACTCCAACGTCTC
ACGTACCGTGAGCGTGTGGAAGTGACGGTCGTACTGCGTCACGTACGCCACAAACTGCGGCAGACGCTTGGCGATCTCCTTCTGCAGCAGTCCGTTGTAC
CTCATCTCTCCTTCCACCGTGATGTTCTTCTTGACGGGGAACTGTCCGCTCAGGATCCGCATCAGCGACGTCTTGCCAGAACCAGGTTGGCCCAGCAATA
GCGTGATAGTACCGGGCTTCAGTACACCGCTGACGTTCTTGATGACTTCCTTGCGCACCACCTTCTTCTTGATCGGGTTGAGATTGGCCAAGGCACGTGC
CACCACGTTGTAGAGCGTAGGCAGCTCCGAGTCGGCCGTCACCTCGCGAGTCACCGTCACGTCGGCTGAGATGGACACGTCGTTGAAGCGCACCTCCATC
TGCGGCAGGACGCCGCCCGTGGCTGCCTTGAAGGTCTCGGCCATGAAGTTGTGCAGCGCCTCGGGGCCCTGTGCCATCATTGTCTCGCCCCAGTGCACGC
TGGCGGGCGTCGTGGGCGTCGATGCTTCCGACATGGTCTTGCTGATGCAGCGGGCGCTTGGGGGCCACGGAGCCGATTCAGAAGTGAAGTGCACACGGTC
TTGTTGCAATGCTGAGTGGAAGCCGTGTGCGCGCGATCAAGATTACTGATTGCTCGTACCGCGGAGATGGGCCCATTTCTATGGCAGCGGAAAAGTCTCA
GCTTCTATCTCTGACAGCAACCTGCAACTAGAGATTCGAAACAAGTCTGTCTATCTCTGACAGTCCCTTCGTCCTAGCTGGTGAGCTGTCTGGGGCGTTG
CAGCGATAGTTGTCCGAGCGAGCCCTTTTCAAGGCGATCTTGGGCGGCAGATGAGACAGGGTCCTTGTTGTCGGCGGGATTATGGCCGACCTGCTCTTCA
GTTGCCGGGGCCGGTGCGTCCTCGAGCGCTCGGCAGGCCTGCTTCGCCATGACGTTCATGCATT