Description :
From Genome Similarity Track
Location :
Scaffold_4:104458- 114446
Transcript NameFunction/comments
Phyca_LT1534503494Hypothetical protein
Phyca_LT1534503496Hypothetical protein
Phyca_LT1534100304Soluble NSF Attachment Protein (SNAP) Receptor (SNARE)
Phyca_LT1534503499tim10 ddp zinc finger domain-containing protein
Phyca_LT1534525496Hypothetical protein

Sequence
9988 bases(100 bases per row)
cggaggcatcttagcctccttctctatcgccctctgcagtatgttcgagcggttaccgcccgacgcgatagctgagtcgcagcttcgcgaagtcatggat
gctacgcttgcgatcctggaccatccgtttgcactgggagacttgacccgagctcgcaatgctgtgggttttgtcctgcgctacggacttaatggatgct
taactgagcgccaacaagaggtgctgcttggcgcttatctgcaaaaactacgagatgaatcgcaagcttcggaaccgaatcaccacaagatactgtcgat
gctagtggagatgagccacatgttccactcgatgggcgaggcttgtgtaaccaatgcgcgtgatgccagtgacattttgcaagggcttatttgccatgaa
aagcaaagtgttcgcttccaagctgccatcgcgctggcttctcttgtcactgcaatcccttaccggcttcaaagtgtcctgacgagttgtctacagggtc
ttcgtgatactgctgagtacctgatgcatggaggctctgacgtcgatgaactgacaaactccggatctgaaaacgtagaagacggtcaagaggaaggcaa
cgacatgcaaagcaagacccatttgtacgcgattcaagggagatcctctgcgattgcacacattcttcgtgccattaagcttaatggcaatggcggctta
tctcaagctactatggacgacatctattccatctccgaagagcttgtcgagagtcagttcctgaatgaatgtgcggacagtatctggctcacttgtacac
gcgctggctggacgttggtcggaagtcttgtggccataaatgatgatcaatggattaaggccaatttggagaggctcctgaatctgtggctcaagtctag
cgtgcttcatagtcgagaatcgtctctcgagctcttgcgtatcgaagccgccgtcattgccctgagcagtttcctggccaattatcagaatgcagctgtc
gactctaacagcgatgtgaatattcttgcgagccacgtactccacgtatacttgatggcgacgcaggacacactgagcaagcctatcaaacgtcgcgggc
agattgcgcgataccgtcttctgggatggatcatcaattgtttctcgatgctccctccaatttacagcgactcatacatcgtcctgttggatctaattgc
tgaattcaccacggctcaggcgttgatgaacctcaggcattcgtccctgatcccggccaaatctacatatctgcaagtgtgctttcttatgacgatgaca
cgcttggcattgtgaccctctcgcggctggatcctggagactatccgtctccactctactcaagagagctgaaccatgtgcttggcttgcagcaacggga
aaacgcgttgacggatacggaactcgaggtccaatatctcgacacgtttttgagatcaatgactgaaaaagaagctgtggatggtgcggccaagcgagca
agttgcagtccgtttacttacgttcggcttgtagacactagtgtgattttgtttggtcgactattccactccattccggaagatcttcaactgcgctgcc
ttcaacactatgctggagctctgtctgatgttcgagctgattgcgaagtcaatgtgtgctcgctactgttcgctgtgattgcagaagcgaggcgtctgga
gaaatctggtgctgccccaacttcttcagcatcgctttctgcaacatcttggcctctgcagatgcaaacgatgctgtgtgaaatgatttcgagtgaaaac
acggttgttcggcgtggtgctggcgaggcactgggctctttagcagtgattctgggggaagatcattgtaaaggtctgattatcgagttagaaaagcgtt
tggtggtggataagcttccgcatggagcctctaacgccacatttggcgccgccgcggacttggatgtgtctgttttatcagctggtgcagcttttgcgtt
agcatgcattaaacgcgtctgtggctcccgtatctcgatcgacaccagcctcattttccgctttgcaggtgagtgctctcagcctctgcggacttggatc
ttacacgcatggggcattattttacagtccgtcaactctaccggaggcgactatgagcagtttgtgaactcaacctttttgttgatggaagcccacgtgc
tggctggttttgtgtactccaaggtcaacaagcgtggattaagatggcaaatcagcaccaaagtagcgcttggacggataattaatgacgtggtggcaac
gcttggtccggagctagatgggtcgaccgatcgcttgaatgaattttactcttactggatgcttcttcgtcaagatggagatgcgcgcgtggagctgcag
ttcttgagatttctggagcaagtcgtcgtgtttgcaccgtcgcgctttcaagctgcagatttacgctacattttgcgcattatttctgataccgctttgt
tgaactctggaactgcatcgtcgcttttagcgcagcagaactctgggcctcaaattttgtcgccgccatcaggaaatgggccatctttaacgactttggg
caactttgagccatttcagaatgatctcgtgagtatcggtgtgtatacaaacggttggagcaggagtatcttgcaaaccgtaggtttatcctgcattcgc
acactggtggagagggatccgacattaattcatcgccagaatctgttttgtctgctgttctcagcactccacgtcgaatacaacgagctgatgtggagct
acttaccaggtctgcatggcatgtgggacgttctctccttcgcctatgctgataatacaactatgcagcgaaatagcattgcggtgttgcagagtgcggc
tttagcactactggatgtcgagggtagagaccacgagagtgccgaaccgtgtctctgggctctattgtgccgtagcattgctatcggtgagtcaataagt
acttttgctggcggtggcgcagaggaacttatgatgagtccgaaaggaatgaacgccggtattcaagtaccaagtactgacactacaggtgacgacatgg
cgtcttggtcaccaaacccagcactagacatgccaaagacagatgcaaactcgttggcatctgaagccatcgccattcaagtgaacacgtggcgagctac
caaggccggtgtgggggaccttatggcattaatgccgcctctttctcgccaagtccgccacttcgcagtggaatgtgtgctacgagtttttgagttgatg
gcagcgaccccaccaatgacaactgacgttggccagaacaagcagcttcacttcgacctcatagcggcaagacgttattttgttgagatgttgtctgctg
gagcacctttacctgtttccaccgactccagcactgggaacttcttgtgtatgtacttggatgagtttgtaactcttgcttgccacgtcaccacgacttc
tgctgaaggggacgagcttctgatgtttcagtgcatgggacttcggctactaaatgttctggtgaagaattttgcgtctgcgagtgatccggaggtggcc
acgggtgatgcttacttgctggacccatatcgtgcccagctttcgtcagccattcgccatgcattgaagcaggtccaagtggaaaatccgccgttgacta
ggagcttggacaatgaaaaaggggaggaaagctacttttacgcgccacttcttctcgaggcgcacacaattgctggttcctgtgtctcatctcacctcat
acaagacaaggttggtttggggcgtatcttgagagcagttgcgactccagactatggtcatgcccatttcatcggagatgaacttacgcgcacttcactt
tctcttgccaacttggcttcagtgggagacctgctatcctccagtgtcgctgaggcaattgctcaaaaggatgcacgtgatgatgagcatcgagcggtag
cggtttctccgcttgtcaaagcgatgaccaacggtttgtcagattccgcggagtacttgtttaagtgctggatggattctacctttgcctatggccttgt
gatgcaaggttctgcgcagtgggctcacttggacacaaattcaagcgcagcgagtgacgaggtgatggtaatgccagctttacgaatgccactccctccg
attggtgtcattccggacgttccgacagccacgttgccgacctcgaaggccttatccgcgctttacaagcgatactggccaaagatcgtccacgcgatgg
catccttggaagtctacttgccaaagttggtctctttgtgcagcacacatggtgggaatattccgaagtggtcgtctgtactgctgtctagtgctatctt
ccacgtcaacgcaaatgctcgggatagaatggaggacgaaagggagctgccagccgttctccacagtatcccgctactattgagagctctgaccgagaat
ccgtctacgcaaggtggctcatccaatgctttcccggtgctcttaaccgctgcactcaatacgacaattctcgctagtaagcgatgttcgggtcttgctc
aaacggaggccctgaaggctatgttctcgtgcttatcgcacgagaatttagcttttgctcgagaggtgtgtcgatctggtgaggatggagaccggcgctc
tgctgccctgttcgacaccgtagtgcaggctggattgtgcccaactgaagtcgtttgtcaaatctgtgatgccaccgagcagactcggcatgctcgcgct
gtcagcattggaagtagaaccactggcgcccgtcgcagttctgttgcaagtgtccaggagacgaagcgtatggctgaaattgtgcagttcgctacgactg
gtattgtgcttctgcacacgactgaagaagcgcggcatggtgtggtgcgctccgtggctttggttcagcaggcgatttgttctgttgcgggtgactatta
ctctcccgttgtcaaagacgccgtggcgacacttagtcgtgcatcgaccgagtcggtctttgcactggcacgtacacttgaagtcaacaacaattcgact
ggcgttcttttccgaatcaagtcgagtgtacgcagttgctttgagttcctcgctgaatggattaaggtagacatccacactgctccaggcttctcgatgc
agattgttgcgaactatgccgtgagcttcccgtcttccgtccaagacgatgcagaacgtttccatgctgagattgcagaaacgtccgccgcaacattgga
gcacactacgctaacgggtggagatgggaagcagcagcactctgccactgcagaacttctgggtggtttgcacgcagtagtgaagaaactcgtcgacgtt
catcaagatgccattttgaaccgttatctggtggctctcggtccttctcttgttgagatcgtcgcagtatcaaacgggtaccccgaaacaccaggtgaac
tcgctgaactggacgaggccgagaagcttcttcgagtgctgacgatgcagttgaaggaccagcacggctccacatttgtacgcatgctcctcccaagact
cgcgactgtacttagtcatcagccgtcatcagctgtagacaacccagtacctgcccaagttcctggcatcttggctcgactacttctatgctttgctcag
acccatgctgctgcgtttaagggagaggtgactgccatgagtccgacgttgcgaggagtacttgagactgcgttacgtcttgctctaaccggatcggttc
ctgccgctggacagacgtcgctttcacaaacgagcagtccttctgctaagcttgacttaagccggtacaattgaccagatctgcagagaatgttttaaat
gagtgaatttacatacatatcgctaagtagcaccttacagcgctcggtgtgtcatgtgtctcgatgctagatcggtaggtcttgttaaaactcatagtgt
cgtctctggacgggaagtcgtggcaacattctgcactgccaagagctccagcaggctgaaaagaactgtgtggacaagttccatgctgtagagctacaga
aaccgagtcagacaagaaaacaagtaaattcttcaattaacagctcacctccacgcccccgtccaggtcaacagccacttcttgcatctcgacccgttcg
atctcgtaagtggataaatcaaatggcaacgagtcgatatacaggcgctccactagctcgataagctctgagaacaatataacacgttagcaattgaccg
cgtatacccgcacatgaagctacagtacctggtacgtaaccggacggacgatttccgtctttcgtctgctgaaaagacgtcgtaacgtagcccagggaac
tgtcattgtgtatgtgcgcacgacatcctcttccttcgtcgcccgatattttaccagcaacggcgctcgcggcggatcttgatctgccatcgagctgtca
cgtggatctgtatcctcttcctggttattcacctcgtgtgaaactcttgacgctctggatcgttcagctagaagactggccacgacccaattacgcgcaa
gacgcttgaggttcatttgctggatgtgaacgacgtgtgtatctacgacgcactggaagcggcgctgcagccaggagcagacccaacgcagtagctcctc
gtttcctctcagcagcaacacttgctgtctctcgcgtcctttacgcggagcgcgttgctcgtgttccgtcgggaaatagagcacaaagccgcctgtgcgc
tccggtccagccttcgcttttccactacggcgtcggtcacgctcttcgcggatctggaaagctacaaacgcgtcggtattgcgaatgctcacgctgtagc
cgaactgctggccgcatgcacgcaacgccgcagagcgcagtgtcttgaccaggtcgtgcgcgtactcgctaagctgctcgcactggaagtggaagagcgg
tgacgcgcagtgcacgacccagcggcggtccagtagcacctgttccatgcttacgcgctcgcgttcacgacgtgcagcagcttctcgcggtgtttcatgc
tcatccggcgcgccggcgccccgtgtgtactgtgacggccgcatgggcgaactgtaggcctctcgaagcttctgctgctgctcggctgtgatcgtctctg
gacacgagttctccatggacggcgactcgacttcttggctgctgttgggacagcaaattgtcatccgtaacggtttatgtcttgtgtgtggactggactt
ctagggtggctcaaaaaaaaatcatttaatgaatttttatcaaagctgacgtcagaggtcggaccctgtggtctaccttgctattcctactggtaaacct
ccgtgaatgactggactacatacaggtgtgcttatccgccggcgagaagcaggaagatgaggatgaccacgagcacgagaatgatgaggtacagcttggt
gttgttgctttgtttggccacctaaaagacgagtacatgtacattagcacgataatgccatagtaatgaaatagaggatctaacgtacccgtgctgcgcg
tgccccctcggactcgagtccgtccgtgacgcgggacacatcgtcatcgatttcgttcagcagccgcacgtgcagctccgtctcgtccttcacagtcaaa
ctgtaggtacgcaggttggacacgccctggccgatcaagtccagctgctgatcctggtccttcataatctggttctgcatgctcaatagtcgtgccggtg
catccgctgctccaggactgcagtacacacacagagtcagtctctgcataacgaacctctctttcagcatgccaacccacctcactgcagctttcgacat
cttccgactgttatacatatccaagtcttcttgctgcaatccaacacactactacgtcagcaacaccactccagtccttaaaacgtcgacgactgtgtac
ctggtcttgtgctaactggtttagcagccgttcacgccgttcaatttcctgttgtgtcctgaagtagtagcgacccattcctgtaagtttacgcattgta
ttacattcctatagcagatcgtacactgagctggacgaccgcttgagttggtcgaaatcgcgcttgagccgggagacgctctgctgcaatgcgaagacgc
tggtaccgatggagcccgagttgcctgtacggatcttactggacagaacctgctcctgactgcgcgcgttctccagccggtccagccacgacgcccacgc
cgtcgtgctcatacttctgctcgttcttctctttcgaaaaatctttaagcctgattgttgaataccggttttgtacctaaattatcggttgtgaatcgga
agtggtgctttcccaccttccattatcgagacacaaaagaccgaaggaaccatgagccagcgggagttcgagcgcaagatggaggagcacattgaggaga
tgcgcgtgacacagaccattgcgtacttcagccgtacggtggagctgtgcttcacggactgcgtgcacgccttccgcagcaagaagctggacgacaagga
gacgtcatgcgtcaacaactgcgcggagaagttcctgcgccacaccatgcgttcctccgtgcgtcttcaggagagttatgccgacattatgcagcagcag
caggaccagcagaaatagacggtttagagcagcgctggcgccgagcaggaacaaggagatggcagaaaatgaacaccattatgacgctcgtagcggcgct
tctgatctgctttctgtgttgtttgttggcgtcgttcatcacgatatactagtaagctacacgtacacgtgtatatccaatttgtagtactgcatcacct
cataaacacaatgagaagctattgatgaccttcctggctcagtagctgatatccctggctttaaagacttgcgtttacttaaaatatttcttttacctct
ctttacaaactttagaaataaaatcccgcccattttcgaactcccatttctccgttctccccaaaaaatggcgtcgtccccaaccagcatcaagtctgac
gacgggcagaccccgataccccgcggttactcgaagcgaggcgatggcttctcggtgcaggagactgagggtctgttggctgaaattcgcgagcgttggc
aagaaggatgggatgtgatcgcagaggtacacaacacacagtttccaggccacaagcgcacggccggctcgctcaagcgcaaattcgccaagctctaccg
cacgaagattgagtcgactaccaaggagaaacatgcacgcgctgccgtcatggccaagaaggtgcgtgaagagatgcgcgtccaacgacgtggactggcg
cctgccgcgcgagggctcgcagacgatctggtagcggatacagacgctgctgtaggcgtgcaaggagtgcacgaggacctaagtgaggttgaaattattg
gttctcaaccagcaacgcagcctcagccgctaaccgaagcacctgtgatacccagtgagcatgagctacgacaaacgttggcaccgggtgtgccattaac
ccagaatacgcccgatgcgtggcaggcggcaattaatcggtggcctattgctggagaatctctacgtaggctacggtcacggactgcgagcggcgagaca
gttgccacacaagatttggcacagacaatgctgatggtgctgctcgattcccagcaccaacgcgacgtagagcgggatcaggagcgcgaggagaggcgac
tggagaggcagcgctggcaggaagagatgcgcgagcaacagcgtcggcacgagcaggaacgcatcgaagatcgtcgacgcaatgagcagttcatgcaggt
gatgacgacgcttgtggcgcagattgcagctggccagcaacgtggtggcttgaattgagctactgtagttggtcaacagttttgcatg