Description :
From Genome Similarity Track
Location :
Scaffold_800:10444- 13536
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_800-snap-gene-0.7Lysosomal alpha-mannosidase

Sequence
3092 bases(100 bases per row)
AATAGCTTCGAAAAGTCCACCTTCACAGACTTTGAGAGACTCTCATGCTCCTCGATAGAGTACAGGTGCGAGAGGCGCACCATGATACAGTCCTTGCTGA
GCTCCTGGAGCGTGGTCAGGCCAACGTTTTCCGGGAATTCGCCGACCTTCAGCCATGGCACCTTCCCTTCGACCTCGGCGTCTGCTGGCACAGGCTTCCG
GAATGCAACCAGTGGGGCGAAAAACTGCTTCTCCATCTTGGTGCGAATGCTGCGAATACCTTCCCTGGCGCTGTCAACGTTGATAAAGAAGTTGCCGCGC
ACAATCAAGCCGCGAACCTTCTCCTTCTGCATAGCCTTGTTAAAGAACGACTCAGTCTCATTCAGGTGCTCGCCCACACCCTTCCCGTCGTCCGCGAGCA
GACGGCGGTGCACCATGACCTCGATCTGACCGTCTTCGAGACTCGCAGCTCCCTGCGCGCGGTCCGTGACAACGTTTAGCTGGTACTTGTCGTCCTTGAT
ATACGCGCCAGTGGTGATCGGGAAGTAATTCGCCGCGACAAACTCTTGATCGTCGTGGAGCGTTAGGTTCCACGTGTCTCGGTGGTTGCGCACGCGCGTG
ACAAACTCGAGTCCGTTCGAGTCCGTGTACAGCGTCTTCGCAGACTTGATGTTGTTCTGGGAATCGAAGCGGATGATCACCTCTTTGCCCTTCTTGTCCT
CAATTGAGATCGAGCCGACCGTCCACTCAATCTCAACAAACTCGTCGCCATCGTTCACGCGGTATTCTAACGTCACCCATCCGCCGATATGGAAGGCGAC
ACGAGACACACTGCCAGACGCAGCGTTCACCTGGAGATCAACAAGGCGCACTTCTTCTGCCCCCTTCCCAGCATGGTACACAGTCTTCGAATCTGGTCGG
AAGATGTACGCCCCCGAGCGCTGTTCATTATCGGCCTGGAACGCTTGGTAATACAACACACTGGAGTTGAGCGGCAGCTCAATGTTCTTCTTCTTGTTCG
TGATGGAGATGATTGAGCCCGTATGTTTCGCGATCTTCACGCGCACCAAGTCGTTCTCGAGCGTCACCACAACTTGGGATTTGTCGCCGAGCGCTGACGA
AATTGTTGAGGGTTTACGAGCCCCATCACTGCTAGACGCCTTCTTCGAAATCATAAAGCGGGCTTCACTCATCGGATCCAGCTCCGTGCTGAACACCAGC
GAGAACGGCGCCGCCTTCTGCTCAGGGTGCACTGGGACAGCAGCAAATACTTCCTGTTGACGCACTTTCGCAGTGCCCGAGATGACTTGGATGTCCACGT
CCTTGTACTTGATCGGGATCGAGATCGTCTGCACGCTCTTGCGCGCCAGCGCGTTGTGTACAAGCGCTTCAAATTTCTACAGAGGTCACAGCACGTTCAT
ATGTTAGCATTCAAGCTCAAGCAGCAGGCAGCAAAAGAGTCCAGGTGTCGCCTGTCACCAGTTGTCATCTGTTGCGTACCTCGTTTGAAGTGGACACGTC
GCACGTACTGGTGTTCGCGAGCAGGCAAAATTCGTACTTCTCCTTCTNNNNNNNNNNAAACACTTCGTTGAACTCTTTTTCAGCTTCCAGGACGCCGTCA
TTGAGGCGCAGCGCGTAGTCATCGGCCACGCTCTGTTTCTCGGTTCCGGAGAGACCGTCATGGTGCTGCACCAGGCCCACGGCGCGCTGAAGCTTGTCGA
GCTGCGCCGAGTGATGGCTCTGGTAAAGCGCGTTCAGCTGGCGTACCTGCTGGAGAAGCGTGTTGGACACGCGCGCGAACCGCTTGAGCCCCGGGCGACT
CGTGAAGAAGCCTGACCAGTACTGGTGCTTACCCGACGAGTACGGAAAGAAATCGTCCGTCTTGACGCTCCACGTGAGATCTTCAGCCAGCTTCAGGTCC
GTGTAGTATGACAGGTTCGAGTACAACACGTTGATCCGGTTGTCTTGGTTCACGTAGTGCTGCAGAAGTATTGAGAAGAAAATTAGAATACAAACTTGTT
CAGGGTGCAGTTTATAAGGCACGTACCACCAGCTTATCCATGTTCTTGTACCACATGCGCGCGTTGTCGAACTGGAAGTCGTCGCCCATGGGGATGAAGA
TGTGGTTTCCCTTTGTACTCGCACCGCGGTCAAGAGACATCTTCACAAAGTCGTCGACTGTCGAGCAGACATTAAAGTCATGCAGCTCCGGGTCGTCCTG
GATCTGGCAGTCGCGGTATCCGTAGTTGAACTCGCGCGGTGGACCATAGTGATCGATGATCTCGCCAGTGAACACCTGCGAGTTTTTGCCGCGCGACTTG
CTCGGACGCCAGATAAACTCGAGGTCTTTCTTCGACTTACGGAGGTCGTAGTCTTGGTAGTCGATGCGCGCAAAGTAGAGCGCGTCAAAGCCCACGCCCG
CGGAGAGCAGCGAGCCTTGCGTGGACGAGTGGCCGAAAGGATCGATTTGCCAGCCAATGCGTGGCGTGACATTGAACTCTTCCTTGAGCAAACGGTGGCC
GTACGCAGTCTGGTCGACCATCGCGGTGTAGTGCGGCGTCGCCTCGTCGTGCATGCACCAGCCGCCATTCACGCTCAGGTCAAGACGACCTTCCTTGACA
AGCTGCTTCACGACCGCCTTGGTCTCCGAGCTCTGCTGATGCCACCAACGCTGGAAGAACGACTGCAGGGACACACACGTGTTGTCAATGACTCGTACGC
CACAAGTAACTTCAGCGCAAGCAAAACGATCAAATCATACCTGCTCCACAAACATGAACTGGCGATCCGGATTCTCCAAGAGCTCCTTCACCACCGTGTC
CAGGATGTACTCCACTCGCTCCATGTAGTACTGGTCGATGCCAACCAGCCATCCTCTACAGATACGCACACACACATATATGGACCAATTAGTACAAATC
ACAAAGCGTTGGCATCATCAGAGCAAACGGTCGCTTCTGACGCACATCAAGAGAAAAAGAAAGAAAACACGCGAGTACGTACGGGTCGTCGTGCGAGTGC
GCGATGAGGTGCACGTTGAGCTTGTGCGGGTCGATCTTCCCCTTCGTGTCGTACTTGGCGTTCACAGGGAGCTTCCACTTGCTCGGGTCGCA