Description :
From Genome Similarity Track
Location :
Scaffold_690:10442- 12241
Transcript NameFunction/comments
g13958.t1hypothetical protein

Sequence
1799 bases(100 bases per row)
AACCCTCTCGCGAGATTCATGCAGCTAAAGCCTGGACAGTGGAAGTGCCCTGGTTGCAGTGTTTTGAACGAGGCGACTAGTGCCAAGTGCCCATGCTGCG
AAACGGCAAACCCTGGAGGTGCGTCTGCAAAGGTTGCTGGTCCTGCAGCGTCGAAGACCCCCGGATCCATTTCATCTATCGGTTTTAGTTTTGGTGTGCC
CGCGTCGGATGATAAGAAGGATACTAACAAACCAGCTGCGGGATCAATTACGACGGGTGGCTTCAGCTTTGGAGCCCCTCCTGCGGACTCGATGGAGAAG
ACCGAGAAGCCTGCTGGGTCGATCTCGTCTGGTGAATTTAGCTTCGGAGTTCCAGCCGCTGATGCAAAGAAAGATACGAACAAGCCTGCGGCTGGAATTA
CGCCCGGTGGGTTTAGTTTTACTGCCCCGGTCGAGAAGCCAGCTGGTGGCTTTAGTTTCGGTGCCCCCGCTGCGTCAGAGGCCAATGCCGATGCTTCTGA
AAGCACTGCCCCGATCTCGTTTGGGTTTTCGGCTCCTGCCAAGAAAATCGAAGATTCGTCGTCAGAGGAGGCAACTGCAACCCCTGCGGTGACTGAAAAT
GGGCAGACTACACAATCATTCTCTTTTGGCGTCCCAGCAGCCTCGGCTTCGGCCTCAGCAGTTACCAGCACAAGTGCGTCAGGTGGATTCACGTTTGGTG
CCGCTAGCTCTAGCACTTTGGAAAACTCCAACAACGGCAAGCGCAAAGCTCCTGAGGCGGAAGAACCTAAGAAAGGCCTGGTTCCTTCGTTTAGCTTCGG
TGCATCCACGCCGGCAACCACCGAAACACCAAAGTCGAGCACTACCACCGGATTCAGCTTTGGCGCCGCACCGGAGCCATCGAGCCCGAAGGAATCGGAC
CGTCCCAAGAAGCGTGCGGCTGTATCGTTTGGCACGGCTGATTCGAAGCCTGAGGCATCAATTCCGGCGTTCTCCTTCGGTACTGCGGTGAAGCCTCCTC
AAATGCCTGCTAAGGATAACGTTGGCGTGAGTTCTACGCCTTCGTTCGGTTTTGGTGGATCTAGCACCTCTACGACGACTACTACTGAAAAGCCAAAGGA
GACGGTGACCTTCAGTTTCGGTACCAGCTCCACCGATAAAGGAAATGTTGCGATGGAGGTGAAGCCGAAAAAATCGTTAGCACCGACGACCGGCTTTACG
TTTGGCTCATCGTCGACTACTACGGCTGCACCGGCAGTGAAACCTAGCATGGAGACAAAGGCACCTGGTTTCTCATTTGGCACTTCGTCAGCCAGTGCGG
CGCCTGCTACGTCCGCGCCTGCTGCATCTTCAACCGGCTTCACTTTCGGCCAGAGCTCAACGGCACCTGCTACTAGCAATGCCCCAGCATTTGGTGCTGC
TCCTGCGACGTCTTCTGCCACCCCTGCTTTCAGCTTCGGAGCTCCCACATCTACGCCGCCTGCCCCTGGAACATCAACTCCTCCCATTGGCCAGTTGTCG
TCGGCTCCTTCCTCGACACCCGGCTTTACGTTTGGTGCTTCGGCTGCTGCGAATCCAGCAGCATCTTCAGGTTTTGGTTCGTTGTCGGGACCCGCGTTTG
GTCAGGCACCAGCGACCACGTCAGGCTTTGGTTCCACCACCGCTAGCTTCGGATCGAGCACGCCTAGTGGCTTTGGATCTGGCCCGAACGCTGGAGCCTT
TGGCAACACGTCTGCTTCTGCCCCTGCGACTTCCTTCGGAAGCTCCACGTCAACTGCACCAACCGCCCCGGCGTTCTCTTTCGGTGCATCGAGCGCTGC