Description :
From Genome Similarity Track
Location :
Scaffold_14:1044198- 1046903
Sequence
2705 bases(100 bases per row)
GTACCGCTTAAGACGTCAAACATAGAACGTCGGGTGCGTCGTCATTGACTTTAGCAGGTGGATGGTGTACGACGCATCATGTCTGACAAGGACTGCAAAT
GGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTGACAGTGTCAAAAGGTAGGTTCCTCGTGTCTAGTAGCACTAAGTCCCCCACTTTAA
ATACACTTAAGTTTACTCTTCCATGTTTGTTGGAGTACTCCTTTTGTTTACCCTGGGCCGCTGCCATGCATCGCGGACCCTGCTGACAACGCTCAGATTG
GTATCCATAAAGGATTCCACTTGTTTTCGCAGCGAAACTGGTCTCACATCCGAGACCTGGGAGGAAATGGCTTTCTGAGCCTCTCCCCCACTTAGAATAG
AGGAGTCAGTTTCCCCTCGAAGAGTGAGAGGCACTCTGTGGTGATGGAAGCCGTTAAAGTAGAACGGCGTGAGCCCCGTGGACGCGTGCACCGCGTTGTT
GAGGCCAAACTTAACAGCTGAAAGCTGCATCGACGACGTACGTGGTGCTGCCGCGCGCACACTGCGTAGAGTGTCCTCGAGCACTCTATTGACGCGCTCT
GTCTGGCCGTCTGTCTGCGGATGGTCCGCAGTGGACATCTGTAGACGAATTCCCAGTAAAGGAAACAGCGTTTTCCAAAACGCAGCCGTGAACCGCGGGT
CTTGGTCCGGGACAATCGTATCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTAACAGTGACGAGAACCGG
AGAAAGATGTACCATCTTGCGCAGCCAAAACACGAACACCAAAATTCCGGTGTTGCCTTGTCCGTCGGCGGGAACCCCAAAGATGAAGTCAAGACACATC
GACTTCCAACAGTCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGAATGACCCGCTGACATGTTTCGCATGTCTTAACGTACC
GGGCGGTCCACGTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCGTGCGC
CTCCGCGAGGATATCGAACTTCAGATCCTCATCGTTGGGTACGACCACCCGTGGAGGTTCATTGGGCTCCACCCGGTAATAGAGGAGGCCATCCTTCAAC
TCATATCGGTGGAGCCGTGAGCGCTGTTGTGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCTGCGATGAGGAACTTGACGATAGGCGCGACAGCCTCAT
CGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGAGATGTGGACCAGCGCATAGTCAGGACGCCGAGAAAGGGCGTCCGCAAG
CACGTTGGGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTACTCCGCGAAGAAGGACAGCCACCTCGCAATCTTTTGGGAGAGGTGAGGCGAGTTTTAG
TCGCCGTCCTCAAGGACGCATGGTCTGTGTAGACCACAAAGCGCCTAGAGCCCAGAAGGTGAACACGAAACTTCACAAGGGCATATTTCATTGCCAAGAG
CTCCTTGTCGTGGACAGGGTAGTTCCGCTCGGCGGCGTTGAGCTGCCTGGACTGGAACGAGATGACTCGTTCCTGACCTGCCGTGTCGGCCTGCAGCAAT
GCACACCCGATTGCGTAATCGGAGGCATCGCAGACGACGCTAAACTGCTTTGTCTCGTCCGGCAGGGCCAGGACAGAGGCCGCTTGGAGATTGGCCTTGA
TGCTGTCAAAAGCATCCTGGTGCTCCTGCTCCCAGCGCCAGTCGACATCCTTCTGAAGGAGGCTCGACAAGGGCTTCGCGAAGCCCGCGTATCCTGCGCT
GTACTTGTGAAGGTAGTTGGCCAAGCCCAGCCACTTTCGAAGATCCTTCTGGGATCAGGGCGTTGGCCATGCTGCTATAGCCTTAACCTTGTCTGGGTCA
GCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGTGAAAACGCACTTGTCGATGTTGGCTAGAGCTTGGTTGCTCGCAT
TACGTCCAGCACTCGACGGAGGTGTCCTAGGTGCACCTCCATGGCCGACTTGCCTCCCTCGGCACGGCTATGGAGAATATGTTGTCAAAGTACGTCTGTA
CGAAGGTACGCAAAGGACGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGCGATGACGGGCCACTCCCAAAGCAT
GCCGCTTGGAGTGCTCACCGCGGTGAGCGGGATGTTGCTCTCTCGCATCAGGATCGGGTAGTATTTGTCTACCAAATTCAACGCGCTGTATAGTACGCTC
CCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACC
TTCCGTTCGGCTTCCGAACGCACAAAGTTGGCGTCGAGTGCAGGGATTGCAACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAAT
GACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTACCAGGCACGAAATTAAATCTCATGCCGTACACCTCGATCCGGTGG
GAGCT