Description :
From Genome Similarity Track
Location :
Scaffold_1167:1044- 2507
Sequence
1463 bases(100 bases per row)
GTTAGCCACTGAAGCGCTGGAATCAAACGTCAGCCGTGTCATCCTAGCTAAAACGCGCAAGTCGGAATTGGCGTCGCTGAAGCGCATCCAGGAAACGATC
TACGAGCCGGATAAAGACTCGGTTAAGGTTTCGTCAAGCGCATCATGAAGAACGACGAGAGACGTCCACCGAAGATCCAATCGGCGAAGATTTGCCAGAC
CATCCGCACAAGACTGTACCAGCGGCCTTTCCCGATGCGGAAGATGTTGACCCGGTAGCAATACAACGGGAACGACGCAGACGGATAATGGTGGCACAAG
ACGAAAAGCAGAAGTGGTCTAACATCAAGAAGGTGCTGCAGGGCCAAGCACAAGAGCTGAGTTAAAAAGAAGCTCGAGATGACAGGAAGTACGCTGACCG
GTTCGTGTTATCAGAAGACGGCGTAATTCACTATCTTGGATTGAATCGTCGGTACGACCACGGTTGGCAAGAAGAGACCAAGCTGCGGCTTGTGGTACCG
ACAGCGATGATTCAAGAGGTCTTGCAGAACTGTCACGACTCGCGGGAAGGAGGACATCAAGGTGTGGTGAGAACGTTCCATCGCGTTAAGTCCAATTATT
ATTGGATCGGCTTGTACGCTGACGTGGAAAAGCATGTGAAGTCATGTCCAGATTGCAGCTTGAGTAAAAGCCGTCCGCAGCTTCGTGGATACTCACCTGG
CAACGTACTAGCCGAACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCCACTACCGAAATCTCGCAGGGGCAACACGGCGTTGCGCCTATTTCAG
TGCTCGTTTACGGGATTCGTTATTGCCAAAGCTATGTCGGATACGACTGCACTGAGTGTTGCCCAAGTGTTCGAATAATGTGTGGACCGACGGTTCGGAG
CCCCATCACTGATAAGGCACGACCGCGACCCACGCTTCATGAGTGAGGATTTCCAAGCGTTCGCAGCGATGATGCAGTCAAGATCACGAGCGACTTTGAG
CTATCGGCCACAGGCTAATGGACAGCAGGAACGCTCGGTGAAGTCGGTGATGGGTTCCGTACGGGTGTACGCGGAAGACCCTTTACAGCAAGATTGGGAT
GAAATCGCAAAGAAGCTAGTGTTTGCTATTAATACTTCTCAGGACACTACAAGGAAGGAAAAATCGTTCTACCTCGTTCATGGTTGGGATGCGCAGTCGA
CGTTGCGGGCGATGTCGTCATCACTCAAACGAGGACTCGGCAAGCAGTCTGACGCACTGGCGTGGTGGCGTGAGATCAATCGACAATATGAGATCGCCCT
AACTATGGCCAAAGATTATCAGGCTGTCGAAAAGGAGCGAAGGGCTAAAAAGCATAATGATGCCCTGTGTCGACTGGAAAAAGCCGCTGTACCTCAACCA
AGTGAAAACGAACACTTGGTGGACCCTCCACAAGCTTCGGAAGAGACAGAAGATCCTGCAACA